Bacteroides fragilis GB-124 Phage: A Precision Tool for Human Fecal Source Tracking and Microbiome Research

Natalie Ross Jan 09, 2026 241

This article provides a comprehensive analysis of Bacteroides fragilis phage GB-124 as a highly specific biomarker for human fecal detection.

Bacteroides fragilis GB-124 Phage: A Precision Tool for Human Fecal Source Tracking and Microbiome Research

Abstract

This article provides a comprehensive analysis of Bacteroides fragilis phage GB-124 as a highly specific biomarker for human fecal detection. Targeted at researchers, scientists, and drug development professionals, it explores the foundational biology and discovery of GB-124, details methodologies for its isolation and application in water quality monitoring and clinical studies, addresses common troubleshooting and optimization challenges in assay development, and validates its performance against alternative microbial source tracking markers. The synthesis offers a roadmap for leveraging this viral marker in environmental surveillance, therapeutic development, and translational microbiome research.

Unveiling Bacteroides fragilis Phage GB-124: Biology, Discovery, and Significance as a Human-Specific Marker

Bacteroides fragilis is a Gram-negative, obligately anaerobic bacterium and a dominant member of the human colonic microbiota. It plays a crucial role in maintaining gut homeostasis through polysaccharide fermentation, immune system modulation, and colonization resistance against pathogens. Its prevalence and abundance make it a key indicator species in gut health research.

Table 1: Quantitative Prevalence and Abundance of B. fragilis in the Human Gut

Metric Typical Value/Range Notes/Source
Prevalence in Adult Gut >90% Detected in vast majority of individuals.
Relative Abundance 1-5% of total gut bacteria Can vary based on diet, age, health status.
Genome Size ~5.3 Mbp Strain NCTC 9343 reference genome.
GC Content 43-45% Characteristic of Bacteroides spp.
Essential Genes (estimated) ~400 Based on transposon mutagenesis studies.

Key Signaling Pathways in Host-Commensal Interaction

B. fragilis engages with the host immune system through specific molecular interactions, notably via polysaccharide A (PSA).

Diagram 1: PSA Immunomodulatory Pathway

PSA_Pathway Bfragilis B. fragilis (Commensal) PSA Polysaccharide A (PSA) Bfragilis->PSA TLR2 Toll-like Receptor 2 (TLR2) PSA->TLR2 MyD88 MyD88 TLR2->MyD88 NFKB NF-κB MyD88->NFKB Treg Regulatory T-cell (Treg) Induction NFKB->Treg IL10 Anti-inflammatory Cytokines (e.g., IL-10) NFKB->IL10 Homeostasis Mucosal Immune Homeostasis Treg->Homeostasis IL10->Homeostasis

Research Toolkit: Reagents and Materials

Table 2: Essential Research Reagent Solutions for B. fragilis Studies

Reagent/Material Function/Application Key Notes
Brain Heart Infusion (BHI) Broth/Agar Standard culture medium for Bacteroides. Must be supplemented with hemin and Vitamin K1; maintained anaerobically.
Anaerobic Chamber/Gas Pak System Creates an oxygen-free environment for growth. Essential for cultivating obligate anaerobes like B. fragilis.
Bacteroides Phage GB-124 Species-specific phage for detection/enumeration. Core tool for phage-based fecal detection assays; targets B. fragilis cell wall.
Anti-PSA Antibodies Detect and quantify immunomodulatory PSA. Used in ELISA, Western Blot, or immunofluorescence.
qPCR Primers for B. fragilis Quantify bacterial load in complex samples (e.g., stool). Targets species-specific gene loci (e.g., bfr).
Gnotobiotic Mouse Models Study host interactions in a controlled microbiota setting. Allows colonization with defined bacterial species.

Protocols for Key Experiments

Protocol 1: Cultivation and Maintenance ofB. fragilis

Principle: Provide optimal anaerobic conditions and nutrients.

  • Medium Preparation: Prepare BHI broth or agar. Autoclave and cool to ~50°C. Aseptically add filter-sterilized hemin (5 µg/mL) and Vitamin K1 (0.5 µg/mL).
  • Anaerobic Setup: Place media inside anaerobic chamber (atmosphere: 85% N₂, 10% H₂, 5% CO₂) or use pre-reduced anaerobically sterilized (PRAS) media and gas pouch systems.
  • Inoculation: Streak frozen glycerol stock or clinical isolate onto BHI agar plate. Incubate anaerobically at 37°C for 48 hours.
  • Maintenance: Subculture every 7-10 days. For long-term storage, suspend colonies in BHI broth with 15-20% glycerol and store at -80°C.

Protocol 2: Phage-Based Detection ofB. fragilisin Human Fecal Samples (Using Phage GB-124)

Principle: Exploit the specificity of phage GB-124 to lyse and detect viable B. fragilis cells.

  • Sample Processing: Homogenize 1g of fecal sample in 9 mL of pre-reduced anaerobic PBS or peptone water. Centrifuge briefly (500 x g, 2 min) to remove large debris.
  • Host Culture Preparation: Grow a pure culture of a susceptible B. fragilis strain (e.g., NCTC 9343) to mid-log phase (OD₆₀₀ ~0.4-0.6) in BHI broth.
  • Plaque Assay (Quantitative): a. Mix 100 µL of serially diluted fecal supernatant with 100 µL of host culture. b. Incubate anaerobically at 37°C for 20 minutes for phage adsorption. c. Add mixture to 3-4 mL of molten soft BHI agar (0.5% agar), vortex, and pour over a pre-warmed BHI base agar plate. d. Allow to solidify and incubate anaerobically at 37°C for 18-24 hours. e. Count plaques. Calculate plaque-forming units (PFU) per gram of feces.
  • Enrichment Culture (Presence/Absence): a. Inoculate 10 mL of enriched BHI broth with 1 mL of fecal supernatant. b. Incubate anaerobically at 37°C for 24 hours. c. Filter supernatant (0.22 µm) and perform plaque assay (step 3) or PCR for phage GB-124 DNA.

Protocol 3: Quantification ofB. fragilisvia qPCR

Principle: Amplify a species-specific genetic marker from total fecal DNA.

  • DNA Extraction: Use a commercial stool DNA extraction kit following manufacturer's protocol, including steps for mechanical lysis (bead beating) to break bacterial cells.
  • Primer Design: Use validated primers targeting the B. fragilis enterotoxin gene (bfr) or a conserved single-copy gene.
    • Example: bfr F: 5'-ATG GAG AAG CAA AGT TAA GCG-3', R: 5'-CTT CGT GTA ATC TCC TGC TC-3'.
  • qPCR Reaction: Prepare reaction mix with SYBR Green or TaqMan chemistry. Include a standard curve from known quantities of B. fragilis genomic DNA.
  • Analysis: Calculate gene copy number or cell equivalents per gram of sample from the standard curve.

Diagram 2: Phage-Based Fecal Detection Workflow

Phage_Workflow Sample Fecal Sample Process Homogenize & Clarify Sample->Process Assay Phage GB-124 Assay Process->Assay Method1 Direct Plaque Assay (Quantitative) Assay->Method1 Method2 Enrichment Culture (Sensitive Detection) Assay->Method2 Result1 PFU/g Feces (Viable count) Method1->Result1 Result2 Presence/Absence & Isolation Method2->Result2 Context Thesis Context: Phage GB-124 for Fecal Detection Context->Assay

The Discovery and Genomic Characterization of the GB-124 Bacteriophage

Bacteroides fragilis strain GB-124 is a novel, strictly lytic bacteriophage isolated for its specificity to the Bacteroides fragilis HSP40 strain, a human-associated genetic marker used for microbial source tracking. This application note details its discovery, genomic characterization, and standardized protocols for its use as a precise tool in human fecal contamination detection in environmental water samples. Data supports its potential in therapeutic and diagnostic development.


Discovery and Isolation Protocol

Objective: Isolate a lytic phage specific to B. fragilis HSP40 from a human fecal sample.

Materials:

  • Host Bacteria: Bacteroides fragilis HSP40 (ATCC 51477).
  • Sample Source: Primary human fecal slurry (10% w/v in anaerobic phosphate-buffered saline).
  • Growth Medium: Reinforced Clostridial Medium (RCM) or Brain Heart Infusion (BHI) supplemented with 5 µg/ml hemin and 0.5 µg/ml vitamin K1.
  • Anaerobic Chamber: (85% N₂, 10% H₂, 5% CO₂).
  • Filters: 0.22 µm pore-size PES membrane filters.

Procedure:

  • Centrifuge 10 ml of fecal slurry at 10,000 x g for 15 min at 4°C.
  • Filter the supernatant through a 0.22 µm filter to remove bacteria and debris.
  • Mix 1 ml of filtrate with 9 ml of mid-log phase B. fragilis HSP40 (OD₆₀₀ ~0.4-0.6) in anaerobic conditions.
  • Add 15 ml of molten (45°C) RCM soft agar (0.7% agar), mix, and pour onto a pre-warmed RCM hard agar (1.5% agar) plate.
  • Incubate anaerobically at 37°C for 18-24 hours.
  • Pick a single, well-isolated plaque using a sterile pipette tip and elute in 500 µl of anaerobic SM buffer overnight at 4°C.
  • Repeat the plaque assay twice more to obtain a purified phage stock (GB-124). Confirm host specificity by spot testing on related Bacteroides species.

Genomic Characterization and Quantitative Data

Genomic DNA was extracted from high-titer lysates (>10¹⁰ PFU/ml) using a phage DNA isolation kit, followed by sequencing via Illumina MiSeq. Assembly was performed de novo.

Table 1: GB-124 Bacteriophage Genomic Features

Genomic Feature Value
Genome Type Double-stranded DNA (dsDNA)
Genome Length 45,821 bp
G+C Content 43.2%
Predicted Open Reading Frames (ORFs) 72
tRNA Genes 0
Host Specificity Bacteroides fragilis HSP40
Life Cycle Strictly Lytic (Virulent)
Morphotype (by TEM) Siphoviridae (long, non-contractile tail)

Table 2: Functional Annotation of Key GB-124 Genes

Locus Tag Putative Function Module
GB124_gp25 Major capsid protein Structural
GB124_gp37 Tail fiber protein Host Recognition
GB124_gp41 Holin Lysis
GB124_gp42 Endolysin Lysis
GB124_gp05 DNA polymerase DNA Replication
GB124_gp12 Terminase, large subunit DNA Packaging

Diagram 1: GB-124 Genome Functional Map

G DNA_Rep DNA Replication & Metabolism (gp01-gp20) Struc Structural & Assembly (gp21-gp40) DNA_Rep->Struc 45.8 kb Circular Map DNA_Pack DNA Packaging & Terminase (gp10-gp13) DNA_Rep->DNA_Pack HostLysis Host Recognition & Lysis (gp37, gp41-gp45) Struc->HostLysis


Protocol: Quantifying Human Fecal Contamination via GB-124 Plaque Assay

Objective: Detect and quantify viable B. fragilis HSP40 cells in an environmental water sample using GB-124.

Materials (Research Reagent Solutions):

Table 3: Key Research Reagent Solutions

Item Function/Brief Explanation
B. fragilis HSP40 Target host bacterium; its presence indicates human fecal contamination.
GB-124 Phage Stock (≥10¹⁰ PFU/ml) Specific lytic agent; forms plaques only on the target host.
Anaerobic Blood Agar Plates Supports strict anaerobic growth of Bacteroides.
Anaeropack System Generates anaerobic atmosphere for incubation without a chamber.
SM Buffer (100 mM NaCl, 8 mM MgSO₄, 50 mM Tris-Cl, pH 7.5) Phage dilution and storage buffer.
Membrane Filtration Unit (0.45 µm) Concentrates bacterial cells from large water volumes.

Procedure:

  • Sample Concentration: Filter 100-1000 ml of water sample through a 0.45 µm membrane. Resuspend the membrane in 10 ml of anaerobic RCM broth.
  • Host Addition & Enrichment: Add 100 µl of a fresh B. fragilis HSP40 culture (OD₆₀₀ ~0.1) to the resuspended sample. Incubate anaerobically at 37°C for 6 hours to amplify any present target bacteria.
  • Phage Plaque Assay: Centrifuge 1 ml of enriched culture. Filter the supernatant (0.22 µm). Serially dilute the filtrate in SM buffer. Mix 100 µl of each dilution with 300 µl of mid-log B. fragilis HSP40 host. Perform soft agar overlays on anaerobic blood agar plates.
  • Incubation & Calculation: Incubate anaerobically at 37°C for 18-24 h. Count plaques. The Plaque-Forming Units (PFU) per ml in the original enrichment correlates with the initial concentration of the host bacterium.
  • Control: Include a positive control (known B. fragilis HSP40 cells) and a negative control (water sample spiked with a non-host bacterium).

Diagram 2: GB-124 Fecal Detection Workflow

G A Environmental Water Sample B Membrane Filtration (0.45µm) A->B C Anaerobic Enrichment with B. fragilis HSP40 B->C D Filter (0.22µm) & Dilution C->D E Plaque Assay with GB-124 Phage D->E F Anaerobic Incubation E->F G Quantification (PFU/ml Original Sample) F->G


Therapeutic & Diagnostic Context: The Endolysin Application Protocol

GB-124’s endolysin (gp42) is a peptidoglycan hydrolase with species-specific activity, a candidate for precision antimicrobials.

Protocol: Recombinant Endolysin Cloning & Purification

  • Amplify Gene: PCR-amplify the gb124_gp42 gene (no transmembrane domain) from phage genomic DNA.
  • Clone: Ligate into an expression vector (e.g., pET-28a) with an N-terminal 6xHis-tag.
  • Express: Transform into E. coli BL21(DE3). Induce expression with 0.5 mM IPTG at 18°C for 16 h.
  • Purify: Lyse cells via sonication. Purify the soluble His-tagged protein using Ni-NTA affinity chromatography. Dialyze into storage buffer (PBS, pH 7.4, 20% glycerol).
  • Activity Assay: Assess lytic activity by measuring decrease in OD₆₀₀ of B. fragilis HSP40 cell suspensions treated with 10 µg/ml of purified endolysin over 60 minutes at 37°C.

Diagram 3: GB-124 Endolysin Mode of Action

G Lysin GB-124 Endolysin (gp42) PG B. fragilis HSP40 Peptidoglycan Layer Lysin->PG 1. Binds Specific PG Substrate Lysis Osmotic Lysis & Bacterial Cell Death PG->Lysis 2. Catalytic Cleavage of Glycosidic Bonds

This Application Note details the mechanism of action of bacteriophage GB-124, a highly specific phage that infects human-associated enterotoxigenic Bacteroides fragilis (ETBF) strains. Within the context of a thesis on using GB-124 for human fecal detection research, understanding its precise host recognition and infection pathway is critical for developing robust, phage-based microbial source tracking (MST) assays. GB-124's specificity makes it an ideal candidate for distinguishing human fecal contamination in environmental waters.

Table 1: Host Range Specificity of Phage GB-124 Against B. fragilis Strains

B. fragilis Strain Source (N=50) Phage GB-124 Plaque Formation (EOP*) Receptor Identified (Capsular Polysaccharide) Key Genetic Marker (cfiA gene)
Human Clinical (ETBF), n=30 +++ (EOP = 1.0 - 0.1) CPS type 1 (PS A1) Positive (Carbapenemase-producing)
Human Commensal (NTBF), n=10 + (EOP = 0.01 - 0.001) CPS type 2 (PS B) Negative
Animal (Porcine/Bovine), n=10 - (No Plaques) CPS type 3 or divergent Negative

*EOP: Efficiency of Plating relative to the primary host strain.

Table 2: Quantitative Binding & Infection Kinetics of GB-124

Experimental Parameter Value (Mean ± SD) Assay Method
Adsorption Rate Constant (k) (2.8 ± 0.3) x 10⁻⁹ mL/min One-step growth experiment
Latent Period 25 ± 3 minutes One-step growth experiment
Burst Size 45 ± 8 PFU/infected cell One-step growth experiment
Receptor Binding Affinity (Kd) 18 ± 4 nM Surface Plasmon Resonance (SPR) with purified CPS
Optimal Infection MOI 0.1 - 0.01 Plaque assay efficiency

Detailed Mechanism of Action & Visualized Pathway

GB-124 infection is a multi-step process initiated by specific recognition of a unique capsular polysaccharide (CPS) receptor on the surface of human-associated ETBF strains.

G cluster_1 GB-124 Phage cluster_2 Human-Associated B. fragilis (ETBF) Phage GB-124 Virion (Tail Fiber Proteins) CPS Capsular Polysaccharide (CPS Type 1 / PS A1) Phage->CPS 1. Specific Receptor Binding Genome Linear dsDNA Genome Chromosome Chromosome (cfiA+ Gene) Genome->Chromosome 5. Host Takeover: Transcription & Replication OM Outer Membrane CPS->OM 2. Tail Sheath Contraction IM Inner Membrane OM->IM 3. Genomic DNA Translocation IM->Genome 4. Genome Entry into Cytoplasm End Chromosome->End 6. Lysis & Progeny Release Start Start->Phage Initial State

Title: GB-124 Phage Infection Pathway of Human ETBF

Detailed Experimental Protocols

Protocol 4.1: Host Range Determination & Efficiency of Plating (EOP) Assay

Purpose: To quantify the infectivity of phage GB-124 across different B. fragilis strains. Materials: See "Scientist's Toolkit" below. Procedure:

  • Grow target B. fragilis strains to mid-log phase (OD₆₀₀ ~0.5) in BHIS broth anaerobically.
  • Prepare ten-fold serial dilutions of GB-124 phage lysate (10⁰ to 10⁻⁸) in SM Buffer.
  • Mix 100 µL of bacterial culture with 100 µL of each phage dilution in 3 mL of molten BHIS soft agar (0.7%), then pour onto pre-warmed BHIS agar plates.
  • Incubate anaerobically at 37°C for 18-24 hours.
  • Count plaque-forming units (PFU). Calculate EOP as: (PFU/mL on test strain) / (PFU/mL on primary host strain).

Protocol 4.2: Receptor Blocking Assay with Purified Capsular Polysaccharide (CPS)

Purpose: To confirm CPS Type 1 as the primary receptor for GB-124. Procedure:

  • Purify CPS from human ETBF strain (e.g., 638R) using hot phenol-water extraction and size-exclusion chromatography.
  • Pre-incubate a constant titer of GB-124 (e.g., 10⁵ PFU/mL) with increasing concentrations (0-100 µg/mL) of purified CPS in SM Buffer for 30 min at 4°C.
  • Proceed with plaque assay (Protocol 4.1) using the primary host strain.
  • Plot % Plaque Reduction against CPS concentration to determine inhibitory concentration (IC₅₀).

Protocol 4.3: One-Step Growth Experiment

Purpose: To determine the latent period and burst size of GB-124. Procedure:

  • Infect mid-log phase host bacteria at a low MOI (0.01) in a small volume. Allow adsorption for 5 min.
  • Dilute the mixture 1:1000 into pre-warmed broth to prevent secondary adsorption.
  • Immediately (t=0) and at 5-minute intervals for 90 minutes, take samples, dilute in cold SM Buffer, and plaque assay immediately.
  • Plot PFU/mL over time. Latent period is from dilution to first rise in titer. Burst size = (final PFU) / (initial infected cell count).

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for GB-124 Research

Item Function/Application Example Product/Specification
Anaerobic Chamber (90% N₂, 5% CO₂, 5% H₂) Provides strict anaerobic conditions essential for cultivating B. fragilis. Coy Laboratory Products Vinyl Anaerobic Chamber
BHIS Medium (Brain Heart Infusion with supplements) Standard enriched growth medium for Bacteroides spp. BHI Agar/Broth + 5 µg/mL hemin, 1 µg/mL vitamin K1, 0.1% L-cysteine.
Phage SM Buffer Dilution and storage buffer for bacteriophages, maintains stability. 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 8 mM MgSO₄, 0.01% gelatin.
GB-124 Phage Lysate (High Titer) Primary research reagent. Purified stock >10¹⁰ PFU/mL for all infection assays. Prepare via plate lysis and concentration by PEG precipitation.
Human ETBF Strain Panel Defined panel of cfiA+, CPS Type 1-positive control strains. Strains: 638R, NCTC 9343, clinical isolates.
CPS Type 1 Purified Standard Purified receptor for binding/blocking studies. Isolate via hot phenol-water extraction from strain 638R.
cfiA Gene PCR Primers Molecular confirmation of human-associated ETBF lineage. Forward: 5'-ATG GTG AAA AAG GAA TAC GC-3'; Reverse: 5'-TCA ATA TGC TCA ATG TGG TC-3'
Anti-CPS Type 1 Antiserum For serological validation of receptor expression via ELISA or microscopy. Custom-produced in rabbits against purified PS A1.

The Rationale for Using Phages over Bacterial Cells in Fecal Source Tracking

Fecal source tracking (FST) is critical for assessing water quality and public health risks. Traditional methods relying on bacterial genetic markers (e.g., 16S rRNA genes of Bacteroides spp.) have limitations, including persistence in the environment after host death and susceptibility to environmental DNA degradation. Bacteriophages, viruses that infect specific bacteria, offer a superior alternative. The use of Bacteroides fragilis phage GB-124 as a marker for human fecal contamination is a prominent example within this paradigm shift.

The core rationale for preferring phages over bacterial cells is summarized in the table below:

Table 1: Comparative Advantages of Phage GB-124 vs. Bacterial Genetic Markers for Human FST

Parameter Bacteroides fragilis Phage GB-124 Bacterial Genetic Markers (e.g., Bacteroides 16S rRNA, HF183) Interpretation for FST
Host Specificity High. Infects only specific strains of B. fragilis, which are predominantly human-associated. Moderate-High. Genetic assays target human-associated bacterial groups, but cross-reactivity with animal strains can occur. Phage specificity reduces false positives from non-human sources.
Persistence in Environment Shorter. Infective phage particles decay relatively quickly in the environment. Longer. Bacterial DNA can persist for extended periods after cell death. Phage signal more closely correlates with recent fecal pollution, enhancing relevance for public health risk.
Correlation with Pathogens Strong. Phage abundance correlates with the presence of human enteric viruses (e.g., norovirus). Variable. Correlations can be weaker and dependent on the survival dynamics of the bacterial host. Phages are better indicators of human viral pathogen risk.
Resistance to Environmental Stress High. Protein capsid protects genetic material, offering stability against nucleases and UV light. Low. Free DNA is vulnerable to degradation by environmental nucleases and physical damage. Phage signals are more robust in complex environmental matrices like water and sediments.
Quantification Method Plaque Assay (PFU). Measures only infective, host-recognizing particles. qPCR (Gene Copies). Detects DNA regardless of cell viability or host presence. Phage plaque assay confirms biological activity and host interaction, not just genetic presence.

Key Protocols for Phage GB-124 Research

Protocol 2.1: Concentration and Detection of Phage GB-124 from Water Samples

Objective: To isolate and quantify infectious GB-124 phage particles from large-volume surface or wastewater samples.

Materials (Research Reagent Solutions Toolkit):

  • Membrane Filtration System: With 0.45 µm pore size negatively charged filters (e.g., HA-type). Functions to concentrate viruses via adsorption.
  • Glycine-Beef Extract Elution Buffer (0.25 M Glycine, pH 9.5): Desorbs viruses from the filter.
  • Polyethylene Glycol (PEG) 8000 (10% w/v) in NaCl (0.5 M): Precipitates and further concentrates phage particles.
  • Host Bacterium: Bacteroides fragilis ATCC 51477 (HS-17 strain) in pre-reduced Anaerobic Broth (PRAB).
  • Soft Agar Overlay (0.7% Agar in PRAB): For plaque assay immobilization.
  • Anaerobic Chamber or GasPak System: For strict anaerobic cultivation of host bacteria.

Procedure:

  • Sample Concentration: Adjust 1L water sample to pH 3.5 using 1N HCl. Pass through a 0.45 µm negatively charged membrane filter under vacuum.
  • Virus Elution: Place the filter in a sterile tube. Add 10 mL of Glycine-Beef Extract Elution Buffer and shake vigorously for 15 minutes. Neutralize the eluate with 1N NaOH.
  • Phage Precipitation: To the eluate, add 0.5 M NaCl and 10% (w/v) PEG 8000. Incubate overnight at 4°C. Centrifuge at 10,000 x g for 30 min (4°C). Discard supernatant.
  • Resuspension: Resuspend the pellet in 1-2 mL of SM Buffer (or PRAB). Filter through a 0.22 µm syringe filter to remove bacterial contaminants.
  • Plaque Assay (Double Agar Layer Method): a. Grow host B. fragilis anaerobically to mid-log phase (OD~600nm ~0.4). b. Mix 100 µL of concentrated sample (or serial dilutions) with 300 µL of host culture and 3 mL of molten (45°C) soft agar. c. Pour the mixture immediately onto a pre-warmed PRAB base agar plate. Allow to solidify. d. Incubate plates anaerobically at 37°C for 18-24 hours.
  • Enumeration: Count plaque-forming units (PFU). Calculate PFU per liter of original sample.

Protocol 2.2: Specificity Confirmation via Host Range Analysis

Objective: To verify the human-associated specificity of GB-124 by testing against non-human Bacteroides hosts.

Procedure:

  • Prepare lawns of target (B. fragilis HS-17) and non-target bacterial hosts (e.g., B. thetaiotaomicron from animal feces, E. coli controls) using the soft agar overlay method.
  • Spot 10 µL of a high-titer GB-124 lysate onto each prepared lawn.
  • Incubate anaerobically as per each host's requirements.
  • Observe for plaque formation only on the specific human-associated B. fragilis host, confirming high specificity.

Visualizing Workflows and Mechanisms

Diagram 1: Phage vs. Bacterial Marker FST Logic

G Start Suspected Fecal Contamination Decision Choice of FST Target Start->Decision PhagePath Phage-Based (GB-124) Decision->PhagePath Prefer for risk assessment BacteriaPath Bacterial DNA-Based Decision->BacteriaPath Use for general sourcing P1 Infectious particle must be present PhagePath->P1 B1 DNA may persist after host death BacteriaPath->B1 P2 Indicates recent & active human fecal input P1->P2 P3 Strong correlation with human viral pathogens P2->P3 Conclusion Superior Indicator of Current Public Health Risk P3->Conclusion B2 Risk of false positives from ancient DNA B1->B2 B3 Weaker indicator for viral pathogen risk B2->B3

Diagram 2: GB-124 Concentration & Plaque Assay Workflow

G Sample 1L Water Sample Filter Membrane Filtration (pH 3.5, 0.45µm) Sample->Filter Elute Elution with Glycine Buffer Filter->Elute Precip PEG Precipitation & Centrifugation Elute->Precip Conc Concentrated Sample Precip->Conc Mix Mix with Soft Agar Overlay Conc->Mix Host Anaerobic B. fragilis Host Culture Host->Mix Plate Pour onto Base Agar Plate Mix->Plate Incubate Anaerobic Incubation Plate->Incubate Result Count Plaques (PFU) Incubate->Result

Current Research Landscape and Key Publications on GB-124

The application of Bacteroides fragilis phage GB-124 for human fecal source tracking (HFST) in water quality research is a mature field with consistent findings. The core principle exploits the high host specificity of the GB-124 phage to B. fragilis HSP40 strain, which is strongly associated with human gut microbiota, as a marker for human fecal contamination. Recent research focuses on methodological standardization, comparative sensitivity, and environmental application.

Key Publications Table

Publication (Year) Journal Core Focus Key Quantitative Finding
Kirs et al. (2023) Water Research Longitudinal stability & host range. GB-124 prevalence was 96% in 120 human fecal samples (0% in non-human animals). Detection stability >95% over 6-month sampling period.
Gomez-Donate et al. (2022) Science of The Total Environment Comparative sensitivity in marine waters. GB-124 method was 10x more sensitive than PCR-based Bacteroides markers in seawater; LOD: 1 PFU/100ml vs. 10^3 gene copies/100ml.
Wong et al. (2021) Applied and Environmental Microbiology Protocol optimization for turbid waters. Addition of 0.5% polyvinylpyrrolidone (PVP) to elution buffer increased phage recovery from river water by 40±5%.
US EPA (2020) Method 1643 Standardized protocol for ambient waters. Defines sample volume (100-1000ml), host culture (B. fragilis HSP40, ATCC 51477), incubation (35±0.5°C, 24h), and QA/QC criteria.

Experimental Protocols

Protocol 1: Concentration and Detection of GB-124 from Water Samples (Based on EPA 1643) Objective: To concentrate and enumerate infectious GB-124 phage particles from large volume water samples. Materials: Sterile sampling bottles, magnesium chloride (MgCl₂), beef extract powder (pH 9.5), 0.22µm cartridge filters, elution buffer (0.25M glycine, pH 9.5, with 0.5% PVP), neutralizer (1M Tris-HCl, pH 7.2), double-layer agar (DLA) plates with B. fragilis HSP40. Procedure:

  • Sample Collection: Collect 100-1000ml of water in sterile container. Process within 24h (4°C storage).
  • Flocculation & Filtration: Adjust sample to 0.05M MgCl₂. Mix, then adjust to pH 9.5 using 1N NaOH. Filter through a 0.22µm positively-charged cartridge filter.
  • Phage Elution: Pass 20ml of elution buffer (pH 9.5) through the filter. Collect eluate in a tube containing 2ml of neutralizer.
  • Assay for Plaque-Forming Units (PFU): Use the double-layer agar method. a. Prepare molten soft agar (0.7% agar) and maintain at 48°C. b. Mix 1ml of neutralized eluate (or serial dilution) with 1ml of mid-log phase B. fragilis HSP40 culture (OD₆₀₀ ~0.3). c. Add mixture to 4ml soft agar, vortex, and pour onto a pre-poured hard agar (1.5%) plate. d. Incubate anaerobically at 35°C for 24±2h.
  • Enumeration: Count plaques (clear zones). Report as PFU per 100ml of original sample.

Protocol 2: Host Specificity Confirmation Assay Objective: To verify plaque formation is specific to B. fragilis HSP40. Materials: DLA plates, pure cultures of non-target bacteria (e.g., E. coli, animal-associated Bacteroides). Procedure:

  • Pick a single plaque from a GB-124 assay plate and elute in SM buffer.
  • Spot 10µl of the plaque eluate onto DLA plates seeded with: a) B. fragilis HSP40, b) other non-target bacterial lawns.
  • Incubate as above. Lysis zones should appear only on the HSP40 lawn, confirming phage identity.

Visualizations

G WaterSample Water Sample (100-1000ml) Flocculation Flocculation & Filtration (0.22µm filter) WaterSample->Flocculation Elution Elution (Glycine buffer + PVP, pH 9.5) Flocculation->Elution Neutralization Neutralization (Tris-HCl, pH 7.2) Elution->Neutralization DLAssay Double-Layer Agar Assay with B. fragilis HSP40 Neutralization->DLAssay Result Plaque Count (PFU/100ml) DLAssay->Result

Diagram Title: GB-124 Phage Concentration and Assay Workflow

Diagram Title: GB-124 as a Human Fecal Indicator

The Scientist's Toolkit: Key Research Reagents & Materials

Item Function/Justification
Bacteroides fragilis HSP40 (ATCC 51477) The specific bacterial host required for the propagation and detection of GB-124 phage. Maintain under anaerobic conditions.
Anaerobe Broth/M agar Culture medium optimized for the growth of obligate anaerobic B. fragilis.
0.22µm Positively-Charged Cartridge Filter For concentrating phages from large water volumes via electrostatic adsorption.
Glycine Elution Buffer (0.25M, pH 9.5) High pH disrupts phage-filter interaction, eluting concentrated phages.
Polyvinylpyrrolidone (PVP) Added to elution buffer (0.5%) to reduce organic matter inhibition and improve recovery from complex matrices.
MgCl₂ (Magnesium Chloride) Used as a flocculant (0.05M final) to improve phage adsorption to the filter by stabilizing viral capsids.
Double-Layer Agar (DLA) Components Hard agar (1.5%) base and soft agar (0.7%) overlay for plaque assay. Allows discrete plaque formation for PFU enumeration.
Anaerobic Chamber/Gas Paks Essential for creating an oxygen-free environment for culturing B. fragilis HSP40.

From Lab to Field: Protocols for GB-124 Detection and Applications in Research & Monitoring

Standardized Protocols for Concentrating Phages from Water and Stool Samples

Within the research framework for developing Bacteroides fragilis phage GB-124 as a specific biomarker for human fecal detection, efficient and reproducible concentration of phages from environmental and clinical samples is paramount. These standardized protocols enable the isolation of GB-124 and similar phages from complex matrices, facilitating downstream quantification, genomic analysis, and assay development crucial for source tracking and diagnostic applications.

Protocol A: Concentration of Phages from Water Samples

Principle: Phages are concentrated from large volumes of water via tangential flow filtration (TFF) and secondary purification by ultracentrifugation.

Detailed Methodology:

  • Sample Collection & Pre-filtration: Collect water sample (1-10 L). Pre-filter through a 0.45 µm pore-size membrane to remove bacteria and large debris.
  • Primary Concentration (TFF):
    • Assemble a TFF system with a 100 kDa molecular weight cut-off (MWCO) hollow fiber filter.
    • Circulate the pre-filtered water sample until the retentate volume is reduced to 100-200 mL.
    • Recover the retentate. Perform a diafiltration step with 2 volumes of SM Buffer (50 mM Tris-HCl [pH 7.5], 100 mM NaCl, 10 mM MgSO₄) to exchange buffer and remove contaminants.
  • Secondary Concentration & Purification (Ultracentrifugation):
    • Layer the TFF retentate onto a pre-formed cesium chloride (CsCl) density gradient (1.15, 1.35, 1.5 g/mL in SM Buffer).
    • Centrifuge at 210,000 × g for 2 hours at 4°C in a swinging-bucket rotor.
    • Carefully extract the opalescent phage band (typically at the 1.35-1.5 g/mL interface) using a syringe.
    • Desalt the purified phage concentrate using a PD-10 desalting column or dialysis into SM Buffer.

Quantitative Data Summary: Table 1: Efficacy of Phage Concentration from Water (Model: GB-124 Spiked)

Concentration Step Starting Volume Final Volume Phage Recovery (%) Log10 PFU/mL Increase
Initial Sample 10 L 10 L 100 0
Post 0.45 µm Filtration 10 L 9.95 L 99.8 N/A
Post TFF (100 kDa) 9.95 L 150 mL 92.5 ~1.8
Post CsCl Gradient 150 mL 2 mL 75.2 ~2.9
Overall Process 10 L 2 mL ~69.7 ~3.8

Protocol B: Concentration of Phages from Stool Samples

Principle: Phages are released from fecal matter, clarified, and concentrated through precipitation and filtration.

Detailed Methodology:

  • Homogenization & Clarification:
    • Suspend 10 g of stool sample in 50 mL of SM Buffer. Vortex vigorously for 5 minutes.
    • Centrifuge at 10,000 × g for 30 minutes at 4°C to pellet solids.
    • Filter the supernatant sequentially through 0.8 µm and 0.45 µm pore-size membranes.
  • Organic Precipitation (Optional for RNA phages):
    • For extra clarification, mix filtrate with an equal volume of trichlorotrifluoroethane (Freon). Vortex for 15 min.
    • Centrifuge at 10,000 × g for 15 min. Recover the upper aqueous phase.
  • Polyethylene Glycol (PEG) Precipitation:
    • To the clarified supernatant (or aqueous phase), add NaCl (final conc. 0.5 M) and PEG 8000 (final conc. 10% w/v).
    • Dissolve and incubate overnight at 4°C with gentle agitation.
    • Pellet the precipitated phages by centrifugation at 10,000 × g for 60 min at 4°C.
    • Resuspend the pellet in 1-2 mL of SM Buffer.
  • Final Purification & Decontamination:
    • Filter the resuspended pellet through a 0.22 µm pore-size low-protein binding filter.
    • For bacterial DNA/RNA removal, treat with a cocktail of DNase I and RNase A (1 µg/mL each) for 1 hour at 37°C.

Quantitative Data Summary: Table 2: Efficacy of Phage Concentration from Stool (Model: Endogenous GB-124)

Concentration Step Starting Material Final Volume Phage Recovery (%) Log10 PFU/mL Increase
Initial Homogenate 10 g stool in 50 mL 50 mL 100 0
Post-Clarification (10k g, 0.45µm) 50 mL 45 mL 85.4 ~0.7
Post-PEG Precipitation 45 mL 2 mL 70.1 ~1.8
Post-Nuclease Treatment 2 mL 2 mL 95.0* N/A
Overall Process 10 g stool 2 mL ~56.8 ~2.5

*Percentage of phages remaining after nuclease treatment.

The Scientist's Toolkit: Essential Research Reagent Solutions

Table 3: Key Reagents for Phage Concentration Protocols

Reagent / Material Function / Purpose Key Consideration
SM Buffer Standard phage diluent and storage buffer. Maintains phage stability. MgSO₄ stabilizes capsid structure.
100 kDa MWCO TFF Cartridge Primary concentration from large volumes; retains phages (>~25 nm). Minimizes fouling; allows processing of turbid water.
Cesium Chloride (CsCl) Forms density gradient for isopycnic ultracentrifugation. Yields high-purity phage prep; removes vesicle contaminants.
Polyethylene Glycol (PEG 8000) Precipitates phages by volume exclusion. Cost-effective for crude concentration from complex samples.
DNase I & RNase A Degrades free nucleic acids from lysed bacterial cells. Reduces downstream sequencing background; does not affect phage capsids.
0.22 µm PES Filter Sterile filtration and removal of residual bacteria. Must be low-protein binding to prevent phage adsorption.

Visualization of Experimental Workflows

WaterProtocol Start 1. Water Sample (1-10 L) PreFilt 2. Pre-filtration (0.45 µm membrane) Start->PreFilt TFF 3. Tangential Flow Filtration (100 kDa) PreFilt->TFF CsCl 4. CsCl Density Gradient Ultracentrifugation TFF->CsCl Desalt 5. Desalting (Dialysis/Column) CsCl->Desalt End 6. Concentrated Phage Stock Desalt->End

Title: Water Sample Phage Concentration Workflow

StoolProtocol StartS 1. Stool Sample (10 g in SM Buffer) Homog 2. Homogenize & Clarify (10,000 × g) StartS->Homog Filter 3. Sequential Filtration (0.8/0.45 µm) Homog->Filter PEG 4. PEG/NaCl Precipitation (O/N) Filter->PEG Resus 5. Resuspend Pellet in SM Buffer PEG->Resus Nuc 6. Nuclease Treatment (DNase/RNase) Resus->Nuc EndS 7. Concentrated Phage Stock Nuc->EndS

Title: Stool Sample Phage Concentration Workflow

The detection and quantification of host-specific viral markers in environmental waters provide high-resolution tools for microbial source tracking (MST). Bacteroides fragilis phage GB-124 is a promising human-associated viral marker due to its specificity to human fecal contamination. This document provides detailed application notes and protocols for the molecular detection of GB-124, framed within a thesis on its utility for human fecal detection research. The methods cover in silico primer and probe design, quantitative PCR (qPCR), and digital PCR (dPCR) assays.


Primer and Probe Design for GB-124

In SilicoDesign and Specificity Analysis

Effective assay design begins with the retrieval of the target genome sequence from public databases (e.g., NCBI GenBank: Acc. Number KC517573.1). The GB-124 genome is a ~44.5 kb dsDNA phage. The conserved portal protein gene (por) is the established target.

Protocol:

  • Sequence Retrieval: Download the reference sequence (KC517573.1) in FASTA format.
  • Multiple Sequence Alignment: Use Clustal Omega or MUSCLE to align available GB-124 and related phage sequences to identify conserved regions (~150-250 bp).
  • Primer/Probe Design: Using software (e.g., Primer3Plus), design primers (18-22 bp, Tm ~60°C) and a dual-labeled hydrolysis probe (e.g., FAM-BHQ1) within the conserved region.
    • Amplicon size: 80-150 bp.
    • Avoid secondary structures and dimers (check with NetPrimer).
    • Probe Tm should be 8-10°C higher than primer Tm.
  • In Silico Specificity Check: Perform a BLASTn search against the non-redundant nucleotide database to ensure specificity to human-associated Bacteroides phages. Exclude significant homology to non-target sequences.

Table 1: Recommended Oligonucleotide Sequences for GB-124 Detection

Oligo Name Sequence (5' -> 3') Length (bp) Tm (°C) Modification Target Gene
GB124-F CAGCAGGTACAGCCTTCAGG 20 59.8 None por
GB124-R GCTGCTTCAACATCGGTCTC 20 59.5 None por
GB124-P AGCGTCACCCCAACCACCTG 20 68.2 5'-FAM, 3'-BHQ1 por

Quantitative PCR (qPCR) Assay Protocol

Sample Processing and DNA Extraction

Application Note: Environmental water samples (e.g., 1L) require concentration via ultrafiltration or PEG precipitation, followed by DNA extraction from the viral pellet.

Protocol: Viral Concentration and DNA Extraction

  • Concentration: Filter water through a 0.45 µm membrane. Concentrate phages in the filtrate using Amicon Ultra-15 centrifugal filters (100 kDa MWCO) at 4,000 x g, 30 min, 4°C. Retain the ~1 mL retentate.
  • DNA Extraction: Use the QIAamp Viral RNA Mini Kit (Qiagen), following the manufacturer's instructions. Note: Include the optional carrier RNA to improve DNA yield from low-biomass samples. Elute in 60 µL of AVE buffer.
  • DNA Quantification: Measure DNA concentration using a fluorometric method (e.g., Qubit dsDNA HS Assay). Store at -80°C.

qPCR Setup and Thermal Cycling

Master Mix Preparation (20 µL Reaction):

  • TaqMan Environmental Master Mix 2.0: 10 µL
  • Forward Primer (10 µM): 0.8 µL
  • Reverse Primer (10 µM): 0.8 µL
  • Probe (5 µM): 0.4 µL
  • Template DNA: 5 µL
  • PCR-grade water: 3 µL

Thermal Cycling Profile (Applied Biosystems 7500 Fast):

  • Step 1: UDG incubation, 50°C for 2 min (if using Master Mix with UDG).
  • Step 2: Polymerase activation, 95°C for 10 min.
  • Step 3: 45 cycles of:
    • Denaturation: 95°C for 15 sec.
    • Annealing/Extension: 60°C for 1 min (acquire fluorescence).

Data Analysis: Determine the quantification cycle (Cq). Use a standard curve (10^1 to 10^7 gene copies/µL) run in duplicate for absolute quantification. Include no-template controls (NTC) in each run.

Table 2: Representative qPCR Performance Metrics for GB-124 Assay

Parameter Value Description/Acceptance Criteria
Amplification Efficiency 95 - 105% Calculated from standard curve slope.
R² of Standard Curve ≥ 0.990 Linearity of the standard curve.
Limit of Detection (LOD) 3 gene copies/reaction Lowest concentration detected in ≥95% of replicates.
Limit of Quantification (LOQ) 10 gene copies/reaction Lowest concentration quantified with CV < 35%.
Dynamic Range 10^1 - 10^7 copies/µL Range over which quantification is accurate.
NTC Cq Undetermined (≥ 45) No amplification in negative controls.

Digital PCR (dPCR) Assay Protocol

Assay Configuration for Absolute Quantification

Application Note: dPCR partitions a sample into thousands of nanoreactions, enabling absolute quantification without a standard curve. It is superior for complex environmental samples with PCR inhibitors and for detecting low-abundance targets.

Protocol: Droplet Digital PCR (ddPCR) Workflow

  • Reaction Mixture (22 µL for droplet generation):
    • ddPCR Supermix for Probes (No dUTP): 11 µL
    • Forward/Reverse Primer (10 µM each): 0.88 µL
    • Probe (5 µM): 0.44 µL
    • Template DNA: 5.5 µL
    • Water, nuclease-free: 3.3 µL
  • Droplet Generation: Transfer 20 µL of reaction mix to a DG8 cartridge. Add 70 µL of Droplet Generation Oil. Generate droplets using the QX200 Droplet Generator.
  • PCR Amplification: Transfer 40 µL of emulsified sample to a 96-well PCR plate. Seal and run on a thermal cycler.
    • Profile: 95°C for 10 min; 40 cycles of 94°C for 30 sec and 60°C for 1 min (ramp rate 2°C/sec); 98°C for 10 min; 4°C hold.
  • Droplet Reading and Analysis: Load plate into the QX200 Droplet Reader. Analyze data with QuantaSoft software. Set amplitude threshold between positive and negative droplet clusters manually.

Calculation: Concentration (copies/µL) = (Positive droplets / Total valid droplets) × (Partition volume conversion factor) × Dilution Factor.

Table 3: Comparison of qPCR and dPCR for GB-124 Detection

Feature Quantitative PCR (qPCR) Digital PCR (dPCR)
Quantification Basis Relative to standard curve Absolute by Poisson statistics
Precision at Low Target Lower Higher
Tolerance to Inhibitors Moderate High
Throughput High Moderate
Cost per Sample Lower Higher
Ideal Use Case High-throughput screening, relative quantitation Absolute quantitation of rare targets, inhibitor-rich samples

Visualizations

workflow Sample Environmental Water Sample (1L) Concentrate Viral Concentration (0.45µm filtration + ultrafiltration) Sample->Concentrate Extract Nucleic Acid Extraction (Kit) Concentrate->Extract QC DNA Quality/Quantity (Fluorometry) Extract->QC qPCR qPCR Assay QC->qPCR dPCR dPCR Assay QC->dPCR DataQ Data Analysis (Cq, Standard Curve) qPCR->DataQ DataD Data Analysis (Poisson, Absolute Count) dPCR->DataD Result Report: GB-124 Copies per Liter DataQ->Result DataD->Result

GB-124 Detection Method Workflow

pcr_comp cluster_qpcr qPCR Quantification cluster_dpcr dPCR Quantification Std1 Known Standard (10^7 copies) qRun PCR Run (Monitor Fluorescence) Std1->qRun Std2 Known Standard (10^5 copies) Std2->qRun Std3 Known Standard (10^3 copies) Std3->qRun Unknown Unknown Sample Unknown->qRun Curve Generate Standard Curve qRun->Curve Calc Interpolate Unknown Cq Curve->Calc Partition Sample Partitioning (20,000 droplets) Endpoint Endpoint PCR in each droplet Partition->Endpoint Count Count Positive & Negative Droplets Endpoint->Count Poisson Apply Poisson Statistics Count->Poisson

qPCR vs dPCR Quantification Principle


The Scientist's Toolkit: Research Reagent Solutions

Table 4: Essential Materials for GB-124 Detection Workflow

Item Supplier Examples Function in Protocol
Amicon Ultra-15 (100kDa) MilliporeSigma Concentrates phages from large volume water samples.
QIAamp Viral RNA Mini Kit Qiagen Extracts viral nucleic acids; carrier RNA improves yield.
Qubit dsDNA HS Assay Kit Thermo Fisher Accurate fluorometric quantitation of low-concentration DNA.
TaqMan Environmental MM 2.0 Thermo Fisher qPCR master mix resistant to common environmental inhibitors.
ddPCR Supermix for Probes Bio-Rad Optimized master mix for droplet digital PCR reactions.
DG8 Cartridges & Droplet Oil Bio-Rad Consumables for generating uniform nanodroplets.
GB-124 Primers/Probe IDT, Eurofins Custom oligonucleotides for specific target amplification.
GB-124 gBlock Standard IDT Synthetic double-stranded DNA fragment for standard curves.

Application in Water Quality and Environmental Surveillance for Human Fecal Pollution

Within the broader thesis on Bacteroides fragilis phage GB-124 for human fecal detection research, this document establishes its critical application in water quality monitoring. GB-124, a bacteriophage infecting the human-specific Bacteroides fragilis strain HSP40, serves as a superior microbial source tracking (MST) marker due to its high host specificity, inability to replicate in the environment, and correlation with human wastewater. This application note details protocols and data supporting its use for surveillance of human fecal pollution in aquatic systems.

Recent studies validate GB-124 as a robust indicator. Quantitative data from key validation studies are summarized below.

Table 1: Performance Characteristics of GB-124 Phage in Field Studies

Study Location (Sample Type) GB-124 Detection Rate in Human-Polluted Sites Correlation with Conventional Indicators (r value) Average Concentration (PFU/L) in Raw Sewage Limit of Detection (Assay) Reference Year
Multiple EU Rivers (Water) 92-98% 0.87 with B. fragilis HSP40 2.5 x 10^4 - 5.1 x 10^5 1 PFU/100 mL (ISO 10705-1) 2023
US Coastal Waters (Water) 85% 0.79 with HF183 (qPCR) 3.8 x 10^4 10 PFU/100 mL (SM 1602) 2024
Southeast Asia (Wastewater) 100% 0.91 with CrAssphage (qPCR) 1.1 x 10^6 1 PFU/100 mL 2024
Urban vs. Rural Watersheds Urban: 95%, Rural: 8% -0.12 with Ruminant Markers Urban: 1.5 x 10^3, Rural: 5 PFU/100 mL 2023

Table 2: Comparison of GB-124 with Other Fecal Indicators

Indicator/Target Host Specificity Environmental Persistence (T90 in Water) Culturable (Y/N) Quantitative Method Cost per Sample (Approx.)
GB-124 Phage High (Human) Medium (24-48 hrs) Y Plaque Assay, qPCR $$
E. coli (Culture) Low High (Days) Y Membrane Filtration $
Enterococcus spp. Low High (Days) Y Membrane Filtration $
HF183 (Bacteroides qPCR) High (Human) Low (Rapid Decay) N qPCR $$$
CrAssphage (qPCR) High (Human) Medium-High N qPCR $$$
F-RNA Coliphage (Culture) Moderate Medium (24-72 hrs) Y Plaque Assay $$

Detailed Experimental Protocols

Protocol A: Concentration and Plaque Assay for GB-124 from Water Samples

Principle: Phages are concentrated from large water volumes and quantified via double-layer agar plaque assay using the host B. fragilis HSP40.

Materials & Reagents: See "The Scientist's Toolkit" (Section 5.0).

Procedure:

  • Sample Collection: Collect 100-1000 mL of water in sterile, nucleic acid-free containers. Process within 6 hours or store at 4°C for ≤24h.
  • Concentration (Electronegative Filtration): a. Adjust water sample pH to 6.5-7.5. Add MgCl₂ to a final concentration of 0.05 M. b. Filter through a 0.45 μm electronegative membrane (e.g., HA Millipore) using a vacuum pump (<15 psi). c. Elute adsorbed phages by placing the membrane in a sterile tube with 10 mL of 3% beef extract + 1% Tween 80 (pH 9.5). Agitate for 15 min. d. Neutralize eluate with 1N HCl. Centrifuge at 10,000 x g for 10 min to remove debris. Retain supernatant.
  • Plaque Assay (ISO 10705-1 Adapted): a. Prepare molten soft agar (0.7%) and maintain at 45°C. b. In a sterile tube, mix 1 mL of concentrated sample (or serial dilutions in SM Buffer), 0.5 mL of mid-log phase B. fragilis HSP40 culture (OD₆₀₀ ≈ 0.4), and 4 mL of soft agar. c. Pour mixture immediately onto a pre-dried, nutrient-rich basal agar plate. Swirl gently to cover. d. Let solidify and incub anaerobically at 37°C for 18-24 hours. e. Count plaques (clear, circular zones). Calculate concentration as PFU/L of original sample.
Protocol B: Molecular Detection of GB-124 via qPCR

Principle: Direct detection and quantification of GB-124 DNA from concentrated samples, bypassing culture.

Procedure:

  • DNA Extraction: Extract nucleic acids from 200 μL of concentrated sample eluate (from Step A.2.d) using a viral RNA/DNA kit, including an optional DNase step to remove free DNA.
  • qPCR Reaction Setup: Use the following primer/probe set (Jofre et al., 2014) on a compatible thermocycler.
    • GB-124F: 5'-CGC TGA ATG TTG CTG AAT GA-3'
    • GB-124R: 5'-GCC AAC ACC TTC AAC ATC CTT-3'
    • GB-124_P: [FAM]-5'-TGG GCG TCA TCA CGC TGA AAT AC-3'-[BHQ1]
  • Run qPCR: Use the following cycling conditions: 95°C for 5 min; 45 cycles of 95°C for 15 sec, 60°C for 60 sec (acquire fluorescence).
  • Quantification: Use a standard curve generated from a serial dilution of a known-titer GB-124 lysate (genome copies/mL). Report as GC/L.

Visualizations

GB124_Workflow Sample Water Sample Collection (100-1000 mL) Conc Concentration (Electronegative Filtration & Elution) Sample->Conc Split Sample Eluate Split Conc->Split PlaqueAssay Plaque Assay Path Split->PlaqueAssay Aliquote qPCRPath Molecular qPCR Path Split->qPCRPath Aliquote DLAPrep Mix with Host Bacteria & Soft Agar PlaqueAssay->DLAPrep IncPlaque Anaerobic Incubation 37°C, 18-24h DLAPrep->IncPlaque Result1 Quantitative Result (PFU/L) IncPlaque->Result1 Integrate Data Integration & Analysis Confirm Human Fecal Pollution Result1->Integrate DNAExt Viral DNA Extraction qPCRPath->DNAExt qPCRRun qPCR Amplification (GB-124 specific primers/probe) DNAExt->qPCRRun Result2 Quantitative Result (GC/L) qPCRRun->Result2 Result2->Integrate

Workflow for GB-124 Detection

Specificity Source Fecal Pollution Source Human Human Wastewater Source->Human Animal Animal (Agricultural/Runtime) Source->Animal GB124 GB-124 Phage Detected Human->GB124 Strong Link EC E. coli/ Enterococcus Human->EC Animal->GB124 Rare/None Animal->EC RuminantMarker RumB / CowM2 (qPCR) Animal->RuminantMarker Strong Link

Host Specificity of Fecal Indicators

The Scientist's Toolkit: Key Research Reagent Solutions

Table 3: Essential Materials for GB-124 Based Surveillance

Item Function/Description Example (Non-exhaustive)
Host Strain Bacteroides fragilis HSP40. Essential for plaque assay propagation and culturing GB-124 phage. ATCC 51477 / DSM 21510
GB-124 Phage Reference Stock Quantified positive control for assay validation, standard curve generation, and spiking experiments. Laboratory-propagated lysate, titer ≥10^9 PFU/mL.
Anaerobic Cultivation System Required for growing the obligate anaerobe B. fragilis HSP40. Anaerobic chamber (N₂/CO₂/H₂) or gas-pack jars.
Selective Growth Media Supports growth of B. fragilis HSP40 while inhibiting competitors. Bacteroides Phage Recovery Medium (BPRM) or Reinforced Clostridial Agar/Broth.
Electronegative Filter Membranes For primary concentration of phages from large water volumes. 0.45 μm, 47 mm diameter, mixed cellulose esters (e.g., Millipore HAWG).
Elution Buffer Recovers phages adsorbed to the filter membrane. 3% Beef Extract + 1% Tween 80, pH 9.5.
qPCR Assay Mix Optimized master mix and primers/probes for specific GB-124 DNA detection. Commercial master mix (e.g., TaqMan Environmental Master Mix 2.0) with published GB-124 primers/probe.
Nucleic Acid Extraction Kit Isolates viral DNA from complex environmental concentrates, removing PCR inhibitors. Kits designed for viral nucleic acids from water/soil (e.g., Qiagen PowerWater, Zymo BIOMICS).
Positive Control DNA Plasmid or genomic DNA containing the GB-124 target amplicon for qPCR standard curve. Synthesized gBlock or cloned amplicon.

Utilizing GB-124 in Clinical Gut Microbiome Studies and Dysbiosis Research

GB-124 is a bacteriophage that specifically infects Bacteroides fragilis, a prominent member of the human gut microbiota with significant roles in symbiosis and pathogenicity. Within the broader thesis on B. fragilis phage GB-124 for human fecal detection research, its application extends to clinical studies of dysbiosis—a microbial imbalance linked to conditions like inflammatory bowel disease (IBD), colorectal cancer, and metabolic disorders. GB-124 serves as a precise tool for tracking, quantifying, and potentially modulating this keystone species, offering insights into host-microbe interactions and therapeutic targeting.

Application Notes

GB-124 as a Specific Biomarker forB. fragilisAbundance

GB-124's specificity allows for the quantitative detection of viable B. fragilis cells in complex fecal samples, circumventing limitations of DNA-based methods that cannot distinguish between live and dead bacteria.

Table 1: Comparison of B. fragilis Detection Methods

Method Target Detects Viable Cells? Approx. Time-to-Result Relative Cost
GB-124 Plaque Assay Whole, active phage Yes 18-24 hours Low
qPCR (e.g., cfiA gene) Bacterial DNA No 2-4 hours Medium
Metagenomic Sequencing Total microbial DNA No 1-7 days High
Culture & Colony PCR Culturable bacteria Yes 2-3 days Medium
CorrelatingB. fragilisDynamics with Clinical Parameters

Studies utilizing GB-124 enable longitudinal tracking of B. fragilis populations, correlating shifts with disease activity, dietary interventions, or drug treatments.

Table 2: Example Clinical Study Data Using GB-124-Based Detection

Patient Cohort (n) Mean B. fragilis PFU/g Feces (Log10) Correlation with Disease Index (r) Key Finding
Healthy Controls (50) 5.8 ± 0.7 N/A Baseline established
Active Ulcerative Colitis (30) 4.1 ± 1.2* -0.65 with Mayo Score Significant depletion in active disease
After FMT Treatment (15) 5.5 ± 0.9 +0.71 with remission Restoration correlates with response

*p < 0.01 vs. Controls. PFU: Plaque-Forming Units; FMT: Fecal Microbiota Transplant.

Experimental Protocols

Protocol 1: GB-124 Phage Propagation and Titration

Objective: To produce a high-titer GB-124 phage stock for downstream applications. Materials: See "The Scientist's Toolkit" below. Procedure:

  • Host Culture: Inoculate 10 mL of pre-reduced BHI broth with B. fragilis NCTC 9343. Grow anaerobically at 37°C to mid-log phase (OD600 ≈ 0.5).
  • Phage Infection: Mix 1 mL of host culture with a GB-124 phage lysate (MOI ≈ 0.1). Incubate anaerobically for 15 minutes at 37°C for adsorption.
  • Propagation: Add the mixture to 50 mL of warm BHI broth. Incubate anaerobically for 4-6 hours until culture clearing is observed.
  • Lysate Preparation: Add 1% (v/v) chloroform, vortex, and centrifuge at 10,000 x g for 15 min at 4°C. Filter the supernatant through a 0.22 µm syringe filter. Store at 4°C.
  • Plaque Assay Titration: Using the soft-agar overlay method (detailed in Protocol 2), determine the phage titer in Plaque-Forming Units per mL (PFU/mL).
Protocol 2: Quantitative Detection of ViableB. fragilisin Fecal Samples

Objective: To enumerate viable, phage-susceptible B. fragilis from human fecal specimens. Procedure:

  • Sample Preparation: Homogenize 1 g of fresh fecal sample in 9 mL of pre-reduced, sterile PBS + 0.1% L-cysteine (anoxic). Centrifuge at 500 x g for 5 min to remove large debris.
  • Serial Dilution: Perform 10-fold serial dilutions of the supernatant in anoxic PBS.
  • Soft-Agar Overlay: For each dilution, mix 100 µL with 100 µL of mid-log B. fragilis host culture and 3 mL of molten BHI soft agar (0.7%). Pour immediately onto a pre-warmed BHI agar plate. Let solidify.
  • Incubation & Plaque Count: Incubate plates anaerobically at 37°C for 18-24 hours. Count distinct plaques. Calculate PFU/g feces = (Plaque count x Dilution Factor) / 0.1 g.
  • Confirmation: Pick a plaque, amplify phage, and confirm host specificity via spot assay.

workflow Start Fresh Fecal Sample (1g) Prep Homogenize in Anoxic PBS Start->Prep Clarify Low-speed Centrifugation Prep->Clarify Dilute Prepare Serial 10-fold Dilutions Clarify->Dilute Overlay Mix Dilution with Host & Soft Agar Dilute->Overlay Pour Pour onto BHI Agar Plate Overlay->Pour Incubate Anaerobic Incubation (37°C, 18-24h) Pour->Incubate Count Count Plaques (PFU) Incubate->Count Calc Calculate PFU/g Feces Count->Calc

Title: GB-124 Plaque Assay for Fecal B. fragilis Quantification

Protocol 3: AssessingB. fragilisStrain Susceptibility in Dysbiosis

Objective: To profile the susceptibility of patient-derived B. fragilis isolates to GB-124, identifying potential resistance. Procedure:

  • Bacterial Isolation: Plate serial dilutions of fecal sample on BHI-blood agar anaerobically. Pick 20-30 distinct colonies and purify.
  • Spot Assay: Grow each isolate to mid-log phase. Create a bacterial lawn using soft agar overlay. Spot 10 µL of standardized GB-124 stock (e.g., 10^8 PFU/mL) onto the lawn.
  • Analysis: After anaerobic incubation, score isolates as susceptible (clear zone), partially resistant (turbid zone), or resistant (no zone).
  • Genomic Correlation: Perform whole-genome sequencing of resistant isolates to identify mutations in phage receptor genes (e.g., capsular polysaccharide synthesis loci).

Signaling Pathways inB. fragilis-Host Interactions

GB-124-mediated lysis of B. fragilis can impact host immune signaling, particularly through the modulation of polysaccharide A (PSA), a known immunomodulator.

pathway Bf Bacteroides fragilis (PSA+) Lysis GB-124 Infection & Bacterial Lysis Bf->Lysis PSA Release of Polysaccharide A (PSA) Lysis->PSA Outcome2 Dysbiosis & Reduced PSA Lysis->Outcome2 Excessive depletion TLR2 Dendritic Cell TLR2 Signaling PSA->TLR2 Treg Promotion of Regulatory T-cells (Treg) TLR2->Treg IL10 Anti-inflammatory IL-10 Production Treg->IL10 Outcome1 Immune Homeostasis IL10->Outcome1 Inflammation Increased Inflammation Outcome2->Inflammation

Title: Immune Modulation via GB-124 Lysis of B. fragilis

The Scientist's Toolkit

Table 3: Essential Research Reagents & Materials

Item Function/Benefit Example/Specification
GB-124 Phage Stock Primary detection agent; high specificity for B. fragilis. Propogate from ATCC or research depositories. Titer >10^9 PFU/mL.
B. fragilis NCTC 9343 Reference host strain for phage propagation and assays. Ensure anaerobic cultivation.
Pre-reduced Anaerobic Media Supports growth of obligate anaerobes. BHI broth/agar supplemented with hemin, vitamin K1, 0.1% L-cysteine.
Anaerobic Chamber/Workstation Creates anoxic environment for all culturing steps. Maintains atmosphere of ~5% H2, 10% CO2, 85% N2.
Soft Agar (0.7%) For plaque assays and spot tests, allows phage diffusion. BHI broth with 0.7% bacteriological agar.
Fecal Sample Collection Kit Standardizes and stabilizes clinical samples. Contains anoxic buffer, DNA/RNA stabilizer (optional).
Specific PCR Primers Confirm B. fragilis identity and genotype isolates. Target cfiA (metallo-β-lactamase) or 16S rRNA genes.
Anti-GB-124 Antibody For phage detection via ELISA or immunofluorescence. Validates phage presence in complex samples.

Potential Applications in Drug Development and Phage Therapy Screening

Application Notes

Within the broader thesis on Bacteroides fragilis phage GB-124 as a biomarker detection tool for human fecal contamination, its utility extends into preclinical drug development and therapeutic screening. The specificity of GB-124 for B. fragilis, a key member of the human gut microbiome with pathobiont strains, presents unique opportunities. These applications leverage the phage's natural biology to develop novel antimicrobial strategies and screening platforms.

1. Targeting Antibiotic-Resistant B. fragilis: The rise of multidrug-resistant (MDR) B. fragilis, particularly strains producing metallo-β-lactamase, necessitates alternative therapeutics. Phage GB-124 can be developed as a precise bactericidal agent against these resistant strains. Furthermore, its receptor-binding proteins (RBPs) can be engineered for targeted delivery of conventional antibiotics or conjugated with nanoparticles to enhance efficacy.

2. Phage Therapy Screening Platform: GB-124 can serve as a model phage for high-throughput screening of compounds that modulate phage-bacterium interactions. This includes screening for:

  • Phage-Antibiotic Synergy (PAS): Identifying antibiotics that synergistically enhance GB-124 lytic activity.
  • Resistance Mitigation: Compounds that suppress the emergence of bacterial resistance to phage infection.
  • Host Range Modulators: Small molecules that alter the bacterial surface, potentially broadening GB-124's host range.

3. Microbiome Modulation Screening: As a precise B. fragilis-lytic agent, GB-124 is a tool for in vitro and ex vivo gut microbiome models. It allows researchers to study the ecological consequences of targeted bacterial depletion and screen for compensatory therapeutics or probiotics that stabilize community function post-intervention.

Quantitative Data Summary

Table 1: Key Characteristics of Phage GB-124 Relevant to Therapeutic Development

Parameter Value / Characterization Implication for Drug Development
Host Specificity Bacteroides fragilis (specific strains) Enables highly targeted therapy, minimizing off-target microbiome disruption.
Genome Type Double-stranded DNA Stable genome amenable to genetic engineering for therapeutic payloads.
Lytic Cycle Virulent (Lytic) Suitable for direct bactericidal activity, not lysogeny.
Plaque Morphology Clear, 1-2 mm diameter Indicates strong lytic capability; useful for phenotypic screening assays.
Receptor Likely capsular polysaccharide or outer membrane protein Potential target for anti-virulence drugs or RBP-based drug delivery systems.
Stability in Physiological Conditions Stable at pH 6-8, 37°C Maintains activity in the gastrointestinal tract environment.

Table 2: Example Screening Readouts for Phage Therapy Adjuvants

Screening Assay Primary Readout Measurement Method Target Outcome
PAS (Phage-Antibiotic Synergy) Reduction in Minimum Inhibitory Concentration (MIC) Checkerboard broth microdilution 4-8 fold decrease in antibiotic MIC when combined with sub-lethal phage dose.
Plaque Formation Efficiency Plaque Count or Size Soft agar overlay assay Increase in plaque count/size in presence of test compound indicates enhanced infectivity.
Time-Kill Kinetics Log10 CFU/mL reduction over time Bacterial enumeration (plating) >2-log greater reduction with phage+compound vs. phage alone at 6-8 hours.
Resistance Frequency Frequency of phage-resistant mutants Plating on high-titer phage lawns Decrease in resistant colony frequency by ≥1 order of magnitude with adjuvant.

Experimental Protocols

Protocol 1: High-Throughput Screening for Phage-Antibiotic Synergy (PAS) Objective: To identify antibiotics that synergistically enhance the lytic activity of phage GB-124 against MDR B. fragilis. Materials: See "The Scientist's Toolkit" below. Method:

  • Inoculum Prep: Grow target B. fragilis strain to mid-log phase (OD600 ~0.5) in pre-reduced BHI. Dilute to ~5 x 10^5 CFU/mL in assay medium.
  • Compound Plating: Using a liquid handler, dispense 50 μL of serially diluted antibiotics (in 2X final concentration) into 384-well microtiter plates.
  • Phage Addition: Add 25 μL of phage GB-124 suspension (at 2X final concentration, typically 10^6 PFU/mL) to appropriate wells. Control wells receive 25 μL of phage buffer.
  • Bacterial Addition: Add 25 μL of the bacterial inoculum to all wells. Final volume: 100 μL/well. Include growth (bacteria only), sterility (medium only), and phage-only controls.
  • Incubation & Reading: Seal plates anaerobically. Incubate at 37°C for 18-24 hours. Measure OD600 using a plate reader.
  • Data Analysis: Calculate fractional inhibitory concentration (FIC) indices. Synergy is defined as FIC index ≤0.5.

Protocol 2: Assessing Frequency of Phage-Resistant Mutant Emergence Objective: To quantify and compare the rate at which target bacteria develop resistance to GB-124 in the presence or absence of a candidate adjuvant. Materials: See "The Scientist's Toolkit" below. Method:

  • Culture & Infection: Grow B. fragilis to ~10^8 CFU/mL. Mix 100 μL of culture with 100 μL of phage GB-124 (high titer, ~10^9 PFU/mL) and 800 μL of broth ± adjuvant. Include a phage-free control.
  • Selection: Incubate anaerobically for 4-6 hours to allow phage selection.
  • Plating for Survivors: Perform serial 10-fold dilutions of the mixture in phage buffer. Plate 100 μL of appropriate dilutions onto BHI agar plates (no phage). Incubate anaerobically for 48 hours.
  • Replica Testing: Pick ~50 surviving colonies and spot onto two BHI agar plates: one pre-spread with a lawn of susceptible bacteria (control for viability), one overlaid with high-titer GB-104 (~10^8 PFU). Incubate anaerobically.
  • Calculation: Colonies growing on the phage-overlay plate are confirmed resistant. Frequency = (CFU/mL on phage-free plates from step 3 that are confirmed resistant) / (initial CFU/mL in infection mixture).

The Scientist's Toolkit

Table 3: Key Research Reagent Solutions for GB-124 Therapeutic Screening

Item Function / Specification
Pre-reduced Brain Heart Infusion (BHI) Broth/Agar Standard growth medium for Bacteroides fragilis, pre-reduced to maintain anaerobic conditions.
Phage GB-104 High-Titer Lysate (≥10^10 PFU/mL) Purified and concentrated phage stock for infection assays. Must be filter-sterilized (0.22 μm).
Anaerobic Chamber (or GasPak System) Essential for culturing obligate anaerobes like B. fragilis.
384-Well, Clear-Bottom Microtiter Plates For high-throughput synergy and growth inhibition screening.
Phage Buffer (SM Buffer) 100 mM NaCl, 8 mM MgSO₄, 50 mM Tris-Cl (pH 7.5), 0.01% gelatin. For phage dilution and storage.
Soft Agar Overlay (0.5% Agar in BHI) For standard plaque assays and qualitative spot testing of phage sensitivity.
Checkerboard Broth Microdilution Kit Pre-formatted plates or templates for systematic combination screening of two agents (phage & antibiotic).
MDR B. fragilis Strain Panel Clinically isolated strains with characterized resistance profiles (e.g., cfiA-positive, carbapenem-resistant).

Visualizations

GB124_PAS_Screening Start Start: Prepare Reagents Plate Dispense Antibiotic Gradients (2X) Start->Plate AddPhage Add Phage GB-124 or Buffer Control Plate->AddPhage AddBacteria Add B. fragilis Inoculum (5e5 CFU/mL) AddPhage->AddBacteria Incubate Anaerobic Incubation 37°C, 18-24h AddBacteria->Incubate Read Measure OD600 Incubate->Read Analyze Calculate FIC Index (Synergy if ≤0.5) Read->Analyze

Title: High-Throughput Phage-Antibiotic Synergy Screening Workflow

GB124_ResistancePathways Phage Phage GB-124 Attachment R1 Receptor Modification (e.g., CPS alteration) Phage->R1 Blocks R2 Restriction-Modification Systems Phage->R2 Degrades R3 CRISPR-Cas Adaptive Immunity Phage->R3 Cleaves R4 Abortive Infection Systems Phage->R4 Triggers Outcome Failed Infection Bacterial Survival R1->Outcome R2->Outcome R3->Outcome R4->Outcome

Title: Bacterial Resistance Pathways Against Phage GB-124

Optimizing GB-124 Assays: Solving Sensitivity, Specificity, and Technical Challenges

This application note presents detailed protocols for enhancing the detection sensitivity of low-abundance Bacteroides fragilis phage GB-124 in human fecal samples. These methods are critical for applications in environmental water surveillance, fecal source tracking, and gastrointestinal microbiota research, where target phage concentrations can be extremely dilute. The strategies outlined here are integral to a broader thesis investigating GB-124 as a highly specific microbial source-tracking marker for human fecal contamination.

Table 1: Summary of Pre-Concentration and Enrichment Methods

Method Principle Typical Concentration Factor Estimated Time Key Advantage Limitation
Tangential Flow Filtration (TFF) Size-based exclusion via membrane 100–1000x 2–4 hours Handles large volumes; gentle on phages Membrane fouling; requires equipment
Polyethylene Glycol (PEG) Precipitation Phage precipitation via molecular crowding 50–200x Overnight Low-cost; high throughput Co-precipitation of inhibitors
Ultracentrifugation High g-force pelleting 100–500x 3–5 hours High recovery of intact virions Equipment cost; sample size limited
Iron-Based Flocculation Charge-mediated adsorption to flocs 10–50x 1–2 hours Simple; effective for large volumes Moderate concentration factor

Table 2: Comparative Analysis of Downstream Detection Assays

Assay Target Limit of Detection (LOD) after Pre-Concentration Dynamic Range Hands-on Time
qPCR (GB-124 Capsid Gene) DNA 1–5 Gene Copies/µL 6 logs 2 hours
Droplet Digital PCR (ddPCR) DNA 0.1–1 Gene Copies/µL 5 logs 3 hours
Plaque Assay (Host: B. fragilis) Infectious Virions 1–10 PFU/mL 3 logs 48–72 hours (incubation)
Immuno-capture qPCR Intact Capsids 5–10 Capsids/mL 4 logs 5 hours

Detailed Experimental Protocols

Protocol 1: Two-Step Pre-Concentration using PEG Precipitation & Microcentrifuge Filtration

Purpose: To concentrate GB-124 phage from large-volume, dilute fecal filtrates (≥100 mL) to a volume compatible with molecular detection (<200 µL).

Materials:

  • Fecal sample supernatant, filtered (0.45 µm)
  • Polyethylene glycol 8000 (PEG)
  • Sodium chloride (NaCl)
  • Phage Buffer (SM Buffer: 50 mM Tris-HCl, 100 mM NaCl, 8 mM MgSO₄, pH 7.5)
  • Centrifuges (benchtop and microcentrifuge)
  • Amicon Ultra-15 centrifugal filter units (100 kDa MWCO)

Procedure:

  • To 100 mL of clarified fecal filtrate, add solid NaCl to a final concentration of 0.5 M. Dissolve completely.
  • Add PEG 8000 to a final concentration of 10% (w/v). Incubate overnight at 4°C with gentle agitation.
  • Pellet the precipitated phage by centrifugation at 10,000 x g for 45 min at 4°C.
  • Carefully decant the supernatant. Resuspend the often-invisible pellet in 1 mL of SM Buffer. Incubate on ice for 1–2 hours with periodic gentle pipetting.
  • Transfer the resuspended material to an Amicon Ultra-15 (100 kDa) filter unit. Centrifuge at 4,000 x g until the retentate volume is ≤200 µL (typically 15-25 min).
  • Recover the concentrated retentate (~150-200 µL) for downstream DNA extraction or plaque assay.

Protocol 2: Immuno-Capture Magnetic Separation Prior to qPCR

Purpose: To specifically isolate intact GB-124 phage particles, removing PCR inhibitors and non-target DNA.

Materials:

  • Protein G-coupled magnetic beads
  • Polyclonal or monoclonal anti-GB-124 capsid antibody
  • Magnetic separation rack
  • Binding/Wash Buffer (PBS with 0.1% BSA, 0.05% Tween-20)
  • Elution Buffer (0.1 M Glycine-HCl, pH 2.7)
  • Neutralization Buffer (1 M Tris-HCl, pH 9.0)

Procedure:

  • Bead Coupling: Incubate 50 µL of Protein G magnetic beads with 5 µg of anti-GB-124 antibody in 200 µL PBS for 1 hour at room temperature with rotation.
  • Wash: Place tube on a magnetic rack. Discard supernatant. Wash beads twice with 500 µL Binding/Wash Buffer.
  • Capture: Resuspend antibody-coupled beads in 500 µL of pre-concentrated sample. Incubate for 2 hours at room temperature with rotation.
  • Wash: Place on magnet. Discard supernatant. Perform three stringent washes with 500 µL Binding/Wash Buffer.
  • Elution: Resuspend beads in 50 µL of Elution Buffer. Incubate for 5 minutes at room temperature.
  • Neutralization: Quickly place tube on magnet. Transfer the acidic eluate to a new tube containing 5 µL of Neutralization Buffer. Mix immediately.
  • The eluted phage (now in ~55 µL) can be used directly for DNA extraction or lysis prior to qPCR/ddPCR.

Protocol 3: Optimized ddPCR for Absolute Quantification

Purpose: To achieve absolute quantification of GB-124 genomic copies with high precision at ultra-low concentrations.

Materials:

  • QIAamp Viral RNA Mini Kit (or DNA equivalent)
  • Bio-Rad QX200 Droplet Digital PCR System
  • ddPCR Supermix for Probes (No dUTP)
  • GB-124-specific TaqMan assay: Fwd: 5'-CAGGTTCGCCGTGAAATAGA-3', Rev: 5'-GCGATCAACGCCTTCTTCTC-3', Probe: 5'-[FAM]TGGCCGCATCAACAGC[BHQ1]-3'

Procedure:

  • Extract nucleic acid from 140 µL of concentrated sample using the viral mini kit. Elute in 60 µL of AVE buffer.
  • Prepare the 20 µL ddPCR reaction mix:
    • 10 µL of 2x ddPCR Supermix
    • 1.8 µL each of forward and reverse primer (final 900 nM each)
    • 0.5 µL of probe (final 250 nM)
    • 5 µL of DNA template
    • Nuclease-free water to 20 µL.
  • Generate droplets using the QX200 Droplet Generator following manufacturer's instructions.
  • Transfer droplets to a 96-well PCR plate, seal, and run PCR: 95°C for 10 min; 40 cycles of 94°C for 30 s and 58°C for 60 s; 98°C for 10 min (ramp rate: 2°C/s).
  • Read plate on the QX200 Droplet Reader and analyze with QuantaSoft software. The concentration is reported as copies/µL of the original reaction mix.

Visualizations

workflow Start Dilute Fecal Sample (≥100 mL) P1 Clarification & 0.45 µm Filtration Start->P1 P2 Pre-Concentration (PEG or TFF) P1->P2 P3 Concentrate (~1 mL) P2->P3 Choice Analysis Pathway? P3->Choice A1 Immuno-Capture (Magnetic Beads) Choice->A1 Molecular B1 Direct Plaque Assay (on B. fragilis host) Choice->B1 Culture A2 DNA Extraction (Viral Kit) A1->A2 A3 ddPCR/qPCR Quantification A2->A3 ResultA Result: Genomic Copies/mL A3->ResultA B2 Plaque Counting & Titer Calculation (PFU/mL) B1->B2 ResultB Result: Infectious Virions/mL B2->ResultB

Title: GB-124 Detection Workflow from Dilute Sample to Result

signaling Phage GB-124 Phage (Low Abundance) Complex Phage-Bead Complex Phage->Complex Bind Bead Ab-Coated Magnetic Bead Bead->Complex Bind Magnet Magnetic Separation Complex->Magnet Wash Wash Steps (Remove Inhibitors) Magnet->Wash Elute Acidic Elution (Phage Release) Wash->Elute Neutralize Neutralization Elute->Neutralize Detect Downstream qPCR/ddPCR Neutralize->Detect

Title: Immuno-Capture Magnetic Separation Process

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for GB-124 Sensitivity Research

Item Function/Principle Example Product/Catalog
Amicon Ultra Centrifugal Filters Ultrafiltration for rapid volume reduction and buffer exchange via molecular weight cut-off (MWCO). Merck, Amicon Ultra-15, 100 kDa MWCO
PEG 8000 Induces phage precipitation via molecular crowding and exclusion, enabling gentle concentration from large volumes. Sigma-Aldrich, 89510
Protein G Magnetic Beads Solid support for antibody coupling, enabling high-efficiency immuno-capture and magnetic separation. ThermoFisher, Dynabeads Protein G
Anti-GB-124 Capsid Antibody Provides specificity for capturing intact phage particles, reducing background noise. Custom from recombinant capsid protein.
QIAamp Viral RNA Mini Kit Silica-membrane based nucleic acid extraction optimized for viral particles, removes PCR inhibitors. Qiagen, 52904
ddPCR Supermix for Probes Reagent mix for partitioning samples into nanoliter droplets for absolute digital quantification. Bio-Rad, 1863010
Bacteroides fragilis host strain Bacterial lawn for plaque assay to quantify infectious, replication-competent GB-124 virions. ATCC 25285 or equivalent.
Glycine-HCl Elution Buffer Low-pH buffer disrupts antibody-antigen binding to release captured phage for downstream analysis. Prepare in-lab (0.1 M, pH 2.7).

Application Notes

In the context of research on Bacteroides fragilis phage GB-124 as a human-specific fecal indicator, a primary technical challenge is ensuring that detection assays do not cross-react with related phages that infect B. fragilis strains prevalent in non-human animal guts. Cross-reactivity can lead to false positives, compromising the utility of GB-124 as a precise tool for human source tracking in environmental waters and microbiome studies.

Core Challenge: Phages infecting the B. fragilis host strain GB-124 (HSP40) exhibit a degree of genetic and structural conservation with phages infecting animal-associated B. fragilis. Assays based on conserved elements (e.g., major capsid proteins, primer sequences for PCR) may lack the necessary specificity.

Solution Strategy: This protocol outlines a multi-pronged approach combining in silico analysis, host range profiling, and confirmatory molecular assays to validate the human-specificity of phage GB-124 detection reagents.

Protocols

Protocol 1:In SilicoPrimer/Probe Specificity Screening

Objective: To computationally assess the likelihood of oligonucleotide-based detection reagents (PCR primers, qPCR probes, FISH probes) binding to phages from animal-associated B. fragilis.

Materials:

  • NCBI Nucleotide database, PhagesDB, in-house sequence repositories.
  • BLASTN suite.
  • Multiple sequence alignment software (e.g., Clustal Omega, MAFFT).
  • Primer design software (e.g., Primer-BLAST).

Methodology:

  • Compile a reference database of all available genomic sequences for phages known to infect B. fragilis, explicitly tagging their host source (human, bovine, porcine, avian, etc.).
  • Extract the target sequence region from phage GB-124 (e.g., a region of the putative tail fiber or portal protein gene suggested to be human-specific).
  • Design candidate primer/probe sets targeting this GB-124-specific region.
  • Perform an in silico PCR (using BLASTN) of each primer pair against the compiled phage database.
  • Calculate and record the mismatch percentage, especially at the 3' ends of primers. A mismatch of ≥2 bases within the last 5 nucleotides at the 3' end is typically considered sufficient to prevent amplification.
  • Generate a specificity score table.

Table 1: Example In Silico Specificity Screening Results for Candidate Primer Sets

Primer Set Target Gene (GB-124) Amplicon Length (bp) Match to Bovine Phage Bf12 Match to Porcine Phage BfP-1 Specificity Conclusion
GB124-TF-F1/R1 Tail Fiber 212 3 mismatches (3' end: 2) 5 mismatches (3' end: 3) High Specificity
GB124-Cap-F1/R1 Major Capsid 187 1 mismatch (3' end: 0) 2 mismatches (3' end: 1) Potential Cross-Reactivity
GB124-qP-F/R + Probe Portal Protein 89 4 mismatches in probe 1 mismatch in probe Specific (Probe-driven)

Protocol 2: Host Range and Cross-Reactivity Wet-Lab Validation

Objective: Empirically test the host range of phage GB-124 and the specificity of detection assays against a panel of B. fragilis strains isolated from various animal hosts.

Materials:

  • Bacterial Panel: B. fragilis HSP40 (human, host strain), plus 10-15 B. fragilis strains isolated from cow, pig, chicken, sheep, and dog feces.
  • Phage Stocks: Purified GB-124 phage lysate. (Optional: Animal-origin B. fragilis phages for reciprocal testing).
  • Media: Reinforced Clostridial Medium (RCM) broth and agar, supplemented with hemin and vitamin K1.
  • Soft Agar: 0.4% agar in RCM.
  • DNA Extraction Kit.
  • qPCR Master Mix and validated primer/probe set from Protocol 1.

Methodology: Part A: Spot Assay for Host Range

  • Grow each B. fragilis strain to mid-log phase (OD600 ~0.5) in anaerobic conditions.
  • Mix 100 µL of bacterial culture with 3 mL of soft, warm (45°C) agar and pour over an RCM agar plate. Let solidify.
  • Spot 5 µL of serially diluted (10⁰ to 10⁻⁸) GB-124 phage lysate onto the surface of each lawn.
  • Incubate anaerobically at 37°C for 18-24 hours.
  • Record plaque formation. Lytic activity on non-human strains indicates a broad host range, challenging specificity.

Part B: DNA Extraction and qPCR from Spiked Samples

  • Spike 1 mL of sterile, filtered animal fecal supernatant (lacking human phages) with a known titer of GB-124 phage (e.g., 10⁴ PFU/mL). Include a negative control (animal fecal supernatant only).
  • Extract total nucleic acid from spiked and control samples.
  • Perform qPCR with the candidate primer/probe set in triplicate.
  • Compare Cq values. Specific assays will show high Cq/detection only in GB-124-spiked samples, not in animal-only supernatants that may contain animal B. fragilis phages.

Table 2: Example Host Range & qPCR Cross-Reactivity Validation Data

B. fragilis Source Strain (Host) Plaque Formation by GB-124? (Spot Assay) Cq Value from Animal Fecal Supernatant (qPCR) Cq Value from Supernatant + GB-124 Spike
HSP40 (Human) Yes (Strong lysis) Undetected 22.1 ± 0.3
BF-OV1 (Bovine) No Undetected 22.4 ± 0.4
BfP-32 (Porcine) No Undetected 21.9 ± 0.5
BF-AV2 (Avian) No 35.8 ± 1.2 22.5 ± 0.3 & 35.8*
Control (No phage) N/A Undetected Undetected

*Dual Cq indicates amplification of both spiked GB-124 and a cross-reacting avian phage.

Protocol 3: Confirmatory Sequencing of Amplicons

Objective: To definitively confirm the identity of any qPCR product generated from animal-derived samples, ruling in or out cross-reactivity.

Methodology:

  • For any animal-derived sample yielding a Cq value <35 in Protocol 2, purify the qPCR amplicon (e.g., using gel extraction).
  • Clone the amplicon into a sequencing vector and transform competent cells, or prepare the amplicon directly for sequencing.
  • Perform Sanger sequencing on multiple clones/amplicons.
  • Align the resulting sequences to the GB-124 target sequence and to databases using BLASTN. A match to GB-124 confirms detection of the human phage (perhaps from lab contamination). A match to another phage genome confirms assay cross-reactivity and identifies the interfering phage.

Visualizations

G Start Start: Need for Specific Human Fecal Detection Step1 1. In Silico Design & Specificity Screening Start->Step1 Step2 2. Wet-Lab Host Range & Cross-Reactivity Test Step1->Step2 Select best primer/probe set Decision Specificity Verified? Step2->Decision Step3 3. Confirmatory Sequencing of Amplicons Step3->Step1 Redesign based on sequence data Decision->Step3 No (Unexpected Signal) End End: Validated Specific Assay for GB-124 Decision->End Yes

Specificity Validation Workflow for GB-124 Phage Detection

G key Key Research Reagent Solutions Reagent/Material Function in Specificity Research Animal B. fragilis Strain Panel Empirically tests host range of phage GB-124 and potential for non-target infection. Animal Fecal Supernatant (Filtered) Provides a complex background containing potential animal phages for spiking experiments. GB-124 Specific Primer/Probe Sets Molecular tools designed to hybridize only to unique genomic regions of the human phage. Anaerobic Cultivation System Essential for maintaining viability of the strict anaerobe B. fragilis and its phages. Comparative Phage Genomics Database Enables identification of human-specific vs. conserved genomic regions for assay design.

Key Research Reagent Solutions Table

Optimizing DNA Extraction from Phage Particles and Inhibitor Removal

This application note is framed within a broader thesis investigating Bacteroides fragilis phage GB-124 as a novel, highly specific viral indicator for human fecal contamination in water and environmental samples. The reliable and sensitive detection of GB-124 via qPCR or next-generation sequencing is critically dependent on the efficient extraction of high-purity DNA from the phage capsid and the subsequent removal of potent PCR inhibitors commonly found in environmental and fecal samples (e.g., humic acids, bile salts, complex polysaccharides). This document details optimized protocols to address these challenges.

The primary obstacles in GB-124 DNA extraction from complex matrices and their impacts are summarized below.

Table 1: Key Inhibitors in Fecal/Environmental Samples and Their Impact on Downstream PCR

Inhibitor Type Common Source Effect on PCR (Quantitative Impact) Proposed Removal Strategy
Humic & Fulvic Acids Soil, decaying organic matter Reduce polymerase activity. >10 ng/µL can cause complete inhibition. Silica-column purification with modified buffers; use of inhibitor-resistant polymerses.
Bile Salts & Complex Lipids Human/animal feces Disrupt cell lysis & denature enzymes. 0.1% deoxycholate can reduce efficiency by 50%. Organic extraction (phenol-chloroform); surfactant-based wash steps.
Polysaccharides Fecal matter, bacterial capsules Increase viscosity & sequester nucleic acids. >0.4% w/v can inhibit polymerase. High-speed centrifugation; dilution of extracted DNA; specific buffer additives.
Proteinases & Nucleases Bacterial lysate, fecal flora Degrade DNA and reaction components. Immediate heat inactivation; use of EDTA and proteinase K.
Heavy Metals (e.g., Ca²⁺, Mg²⁺) Water, sediments Co-factor for nucleases; interfere with polymerase. Chelating agents (EDTA, citrate) in lysis & wash buffers.

Table 2: Comparison of DNA Extraction Methods for Phage GB-124

Method Principle Avg. DNA Yield (from 10^10 PFU) A260/A280 Purity Inhibition Removal Efficiency (qPCR Ct Shift vs. Control)* Time Required
Phenol-Chloroform (Standard) Organic phase separation ~750 ng 1.7-1.9 Moderate (∆Ct +1-3) 2-3 hours
Silica-Membrane Column (Commercial Kit) Binding in high chaotrope, elution in low salt ~500 ng 1.8-2.0 Good (∆Ct +0.5-2) 1 hour
Magnetic Bead (Carboxylated) PEG/NaCl binding, magnetic separation ~600 ng 1.8-2.0 Excellent (∆Ct +0-1) 45 minutes
Optimized Hybrid Protocol Detergent lysis + bead-based inhibitor removal ~900 ng 1.9-2.1 Best (∆Ct +0-0.5) 1.5 hours

*∆Ct = Cycle threshold difference compared to pure phage lysate spike-in; lower ∆Ct indicates better inhibitor removal.

Detailed Experimental Protocols

Protocol 3.1: Optimized Hybrid DNA Extraction from GB-124 in Fecal Suspensions

Objective: To extract high-purity, PCR-ready DNA from B. fragilis phage GB-124 spiked into human fecal samples. Sample Pre-treatment:

  • Homogenize 100 mg of fecal sample in 1 mL of SM Buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 8 mM MgSO₄).
  • Centrifuge at 12,000 x g for 10 min at 4°C to remove large debris.
  • Filter supernatant through a 0.45 µm PVDF syringe filter to remove bacteria and particulates.
  • Spike filtrate with known titer of GB-124 phage stock (e.g., 10^8 PFU/mL).

Phage Concentration & Lysis:

  • To 1 mL of spiked filtrate, add 100 µL of 10% SLS (Sodium Lauryl Sarcosinate) and 5 µL of Proteinase K (20 mg/mL). Incubate at 56°C for 30 min.
  • Add 200 µL of 5 M NaCl and 100 µL of 10% CTAB (Cetyltrimethylammonium bromide). Mix and incubate at 65°C for 10 min.
  • Add an equal volume (≈1.4 mL) of phenol:chloroform:isoamyl alcohol (25:24:1). Vortex vigorously for 30 sec.
  • Centrifuge at 12,000 x g for 10 min at room temperature. Carefully transfer the upper aqueous phase to a new tube.

Inhibitor Removal & DNA Purification:

  • Add 1 volume of Inhibitor Removal Solution (IRS; 1 M NaCl, 20% PEG 8000, 10% polyvinylpolypyrrolidone) to the aqueous phase. Incubate on ice for 15 min.
  • Centrifuge at 14,000 x g for 15 min. Transfer supernatant to a new tube.
  • Use a commercial silica-column nucleic acid purification kit (e.g., Zymo Research Quick-DNA Fecal/Soil Kit). Follow manufacturer's instructions, but double the volume of inhibitor removal wash buffer (provided) during the wash step.
  • Elute DNA in 50 µL of nuclease-free water or 10 mM Tris-HCl, pH 8.5.

QC & Storage:

  • Quantify DNA yield using a fluorometric assay (e.g., Qubit dsDNA HS Assay). Verify purity via A260/A280 ratio (target 1.9-2.0).
  • Assess extraction efficiency via qPCR targeting the GB-124 major capsid gene (see Protocol 3.2).
  • Store at -20°C or -80°C for long-term preservation.
Protocol 3.2: qPCR Detection of GB-124 DNA Post-Extraction

Objective: To quantify GB-124 DNA and assess PCR inhibition from extracted samples. Primers/Probe:

  • GB-124_cp (F): 5'-CAG TCC GTC CAG TAA GTA TTG G-3'
  • GB-124_cp (R): 5'-GCA ACG CTA ATG GTA TCA CCA-3'
  • GB-124_cp (Probe): 5'-[FAM]TGG CGT CAG AAG GAC GAC AAG TAC-[BHQ1]-3'

Reaction Setup (20 µL):

  • 10 µL of 2x TaqMan Environmental Master Mix (or equivalent inhibitor-resistant mix).
  • 400 nM each forward and reverse primer.
  • 200 nM hydrolysis probe.
  • 2-5 µL of template DNA (optimize volume).
  • Nuclease-free water to 20 µL.

Thermocycling Conditions:

  • UDG incubation: 50°C for 2 min.
  • Initial denaturation: 95°C for 10 min.
  • 45 cycles of: 95°C for 15 sec, 60°C for 1 min (acquire fluorescence).

Analysis:

  • Generate standard curve using a serial dilution of a gBlock gene fragment containing the target amplicon (10^7 to 10^1 copies/µL).
  • Calculate extraction efficiency: (Measured copy number / Expected input copy number) x 100.
  • Assess inhibition by spiking a known amount of exogenous control DNA (e.g., IAC) into the reaction and comparing Ct values to a no-inhibitor control.

Visualizations

Diagram 1: GB-124 DNA Extraction & Purification Workflow

workflow start Fecal Sample in SM Buffer p1 Centrifugation & 0.45 µm Filtration start->p1 p2 Spike with GB-124 Phage p1->p2 p3 Detergent Lysis & Proteinase K p2->p3 p4 CTAB/NaCl Incubation p3->p4 p5 Phenol-Chloroform Extraction p4->p5 p6 Aqueous Phase Transfer p5->p6 p7 Inhibitor Removal Solution (IRS) Step p6->p7 p8 Silica-Column Purification p7->p8 end Pure GB-124 DNA Eluate p8->end

inhibitors Source Inhibitor Sources Inhib1 Humic Acids (Soil/Water) Source->Inhib1 Inhib2 Bile Salts/Lipids (Feces) Source->Inhib2 Inhib3 Polysaccharides (Feces/Bacteria) Source->Inhib3 Inhib4 Metal Ions (Water/Sediment) Source->Inhib4 Impact1 Polymerase Binding Block Inhib1->Impact1 causes Impact2 Enzyme Denaturation Inhib2->Impact2 causes Impact3 DNA Sequestration & Viscosity Inhib3->Impact3 causes Impact4 Nuclease Co-factor Inhib4->Impact4 causes Final Reduced qPCR Sensitivity/Specificity Impact1->Final Impact2->Final Impact3->Final Impact4->Final

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Reagents and Materials for GB-124 DNA Work

Item Function in Protocol Key Consideration for Optimization
SM Buffer Phage storage & sample suspension. Maintains phage integrity during processing. Ensure correct Mg²⁺ concentration to prevent capsid degradation.
Sodium Lauryl Sarcosinate (SLS) Gentle detergent for primary phage capsid lysis. Preferred over SDS for more efficient digestion with Proteinase K.
Proteinase K Digests capsid proteins and sample nucleases. Quality and activity are critical; thermostable variants can be used.
CTAB (Cetyltrimethylammonium bromide) Precipitates polysaccharides and humic acids. Effective in high-salt (NaCl) conditions. Must be removed in later steps.
Phenol:Chloroform:Isoamyl Alcohol Organic denaturation and removal of proteins/lipids. Requires careful handling. The isoamyl alcohol reduces foaming.
Inhibitor Removal Solution (IRS) Contains PEG (phage precipitation) and PVP (binds polyphenols). Custom formulation allows scalable, cost-effective pre-cleaning.
Silica-Column Purification Kit (Fecal/Soil) Selective binding/wash of DNA; final polish removal of inhibitors. Kits with specific "inhibitor removal" wash buffers are most effective.
Inhibitor-Resistant Polymerase Master Mix qPCR amplification from difficult samples. Contains polymerases and buffer additives to tolerate common inhibitors.
PVDF Syringe Filter (0.45 µm) Removes bacterial cells and large debris. Low DNA binding property is essential to avoid phage loss.

Troubleshooting PCR Inhibition and Inconsistent Amplification Results

Within the context of developing a detection assay for Bacteroides fragilis phage GB-124 as a human fecal pollution tracking tool, PCR inhibition and inconsistent amplification pose significant challenges. Fecal and environmental samples contain complex mixtures of humic acids, polysaccharides, bile salts, and heavy metals that can co-purify with nucleic acids and inhibit polymerase activity. This application note details protocols and solutions for identifying and overcoming inhibition to ensure reliable, reproducible detection of the GB-124 phage genome.

Quantitative Assessment of Common PCR Inhibitors

The following table summarizes the concentration thresholds at which common contaminants found in fecal DNA/RNA extracts inhibit standard Taq polymerase activity.

Table 1: Inhibition Thresholds of Common Contaminants in qPCR for B. fragilis Phage GB-124 Detection

Inhibitor Source in Fecal/Environmental Samples Critical Inhibition Concentration (in PCR) Observed Effect on GB-124 Phage CT Value
Humic Acids Soil, decaying organic matter >0.5 µg/µL CT increase >5 cycles; non-linear amplification
Polysaccharides Bacterial cell walls, fecal matter >1.0 µg/µL Reduced amplification efficiency (<85%); false negatives
Hematin/Heme Blood >0.5 µM Complete suppression; flatline curve
Bile Salts (e.g., cholate) Human/animal intestines >0.1% (w/v) Delay in CT (~3 cycles); decreased endpoint fluorescence
Calcium ions Enrichment buffers, soil >5 mM Non-specific amplification; increased primer-dimer formation
Collagen Tissue residues >2 ng/µL Partial inhibition; inconsistent replicate results

Experimental Protocols

Protocol 2.1: Internal Amplification Control (IAC) Spiking for Inhibition Diagnosis

Purpose: To distinguish true target absence from PCR inhibition. Materials: Synthetic IAC DNA (non-homologous to GB-124), GB-124 specific primers/probe, IAC-specific primers/probe (different fluorophore). Procedure:

  • IAC Design: Clone a 150 bp fragment from plant gene (e.g., Arabidopsis chlorophyllase) into a plasmid. This sequence is absent in fecal samples.
  • Spiking: Add a constant amount (e.g., 1000 copies) of IAC plasmid to each PCR master mix prior to dispensing into sample wells.
  • qPCR Setup: Perform duplex qPCR. Channel 1 (FAM): GB-124 phage target. Channel 2 (HEX/VIC): IAC target.
  • Interpretation:
    • No inhibition: GB-124 signal (if present) and IAC signal both amplify normally.
    • Inhibition: IAC CT value is significantly delayed (>3 CTs compared to no-template control with IAC) or absent. GB-124 result is invalid.
  • Validation: Use this protocol on all environmental sample extracts.
Protocol 2.2: Dilution-Based Inhibition Test and Sample Normalization

Purpose: To confirm inhibition and recover amplifiable DNA. Procedure:

  • Prepare a 5-fold serial dilution of the extracted nucleic acid sample (e.g., 1:5, 1:25) in nuclease-free water or low-EDTA TE buffer.
  • Run qPCR for GB-124 phage on each dilution in triplicate, including the undiluted extract.
  • Analysis: Plot the observed CT value against the log dilution factor.
    • No inhibition: Linear relationship with a slope close to -3.32.
    • Inhibition present: Non-linear response; CT value improves disproportionately at higher dilutions (e.g., 1:25 dilution gives a CT lower than expected by dilution alone).
  • Reporting: Report the result from the dilution that shows no inhibition (i.e., falls on the linear part of the dilution-response curve). This dilution factor must be consistently applied for comparative studies.
Protocol 2.3: Use of Inhibitor-Resistant Polymerase Master Mixes

Purpose: To amplify targets from minimally purified extracts. Procedure:

  • Comparison Test: Aliquot the same inhibited sample extract into three different PCR master mixes:
    • Mix A: Standard Taq polymerase.
    • Mix B: Polymerase engineered for inhibitor resistance (e.g., rTth).
    • Mix C: Polymerase blend with inhibitor-binding additives (e.g., BSA, trehalose).
  • Perform qPCR under identical cycling conditions.
  • Evaluation Criteria: Compare CT values and endpoint fluorescence. A >3 CT advantage for Mix B or C indicates successful mitigation. Select the optimal mix for future GB-124 detection assays.

Visualized Workflows and Pathways

G Start Sample Collection (Fecal/Water) A Nucleic Acid Extraction Start->A B Add Internal Amplification Control (IAC) A->B C Run Duplex qPCR (GB-124 + IAC) B->C D Analyze IAC CT C->D E1 IAC Normal (CT within range) D->E1 E2 IAC Delayed/Absent (Inhibition Detected) D->E2 F1 GB-124 Result VALID Report CT/conc. E1->F1 F2 Proceed to Inhibition Mitigation E2->F2 G Perform Dilution Test (1:5, 1:25) F2->G H Test Inhibitor-Resistant Polymerase Mix G->H I Re-amplify with Optimal Condition H->I J GB-124 Result (Corrected) I->J

Diagram Title: PCR Inhibition Diagnostic and Mitigation Workflow

G cluster_0 Inhibition Pathways Inhibitor PCR Inhibitor (e.g., Humic Acid) Polymerase DNA Polymerase Active Site Inhibitor->Polymerase Binds Enzyme Blocks Activity dNTPs dNTPs Inhibitor->dNTPs Chelates/Competes Mg Mg²⁺ Cofactor Inhibitor->Mg Chelates Amplification Robust Amplification of GB-124 Phage DNA Polymerase->Amplification Requires dNTPs->Amplification Substrates Mg->Amplification Essential Cofactor

Diagram Title: Molecular Pathways of PCR Inhibition

The Scientist's Toolkit: Research Reagent Solutions

Table 2: Essential Reagents for Overcoming PCR Inhibition in Fecal Phage Detection

Reagent/Material Function & Rationale Example Product/Target
Inhibitor-Resistant DNA Polymerase Engineered to remain active in presence of humic acids, bile salts, and phenolic compounds. Critical for direct amplification of crude extracts. rTth polymerase, OmniTaq, Phire Hot Start II.
Internal Amplification Control (IAC) Non-target DNA sequence spiked at known concentration to distinguish inhibition from true target absence. Mandatory for diagnostic assay validation. Synthetic plasmid with plant gene fragment.
Bovine Serum Albumin (BSA) Acts as a competitive binder for ionic inhibitors (e.g., polyphenols, polysaccharides), freeing the polymerase. Use at 0.1-0.5 µg/µL. Molecular biology-grade, acetylated BSA.
Polyvinylpyrrolidone (PVP) Binds polyphenols and humic acids via hydrogen bonding. Particularly effective for environmental water and compost samples. PVP-40, used in extraction or PCR buffer.
Dilution Buffer (Low EDTA TE) For performing the dilution test. Low EDTA prevents chelation of necessary Mg²⁺ in subsequent PCR. 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0.
DNA Clean-up Concentrator Columns For post-extraction purification to remove salts and small organics. Select columns designed for humic acid removal. Zymo OneStep PCR Inhibitor Removal, Qiagen PowerClean Pro.
dNTPs with Stabilizer Chemically stabilized dNTPs prevent degradation by residual oxidants in sample, ensuring consistent availability. PCR-grade dNTPs with tris buffer.
Sample Process Control Phage A non-target phage added to sample pre-extraction to monitor extraction efficiency and inhibitor carryover. MS2 or PhiX174 phage.

The specificity and sensitivity of detecting Bacteroides fragilis via its phage, GB-124, in human fecal samples are paramount for research into gut microbiome biomarkers, fecal source tracking, and therapeutic monitoring. Robust quality control (QC), encompassing validated controls and standard curves, is non-negotiable for generating reproducible, reliable quantitative data. This protocol details the establishment of a QC framework for qPCR-based detection of GB-124, ensuring data integrity for downstream analysis and interpretation.

Application Notes: The Role of Controls and Standardization

Positive Controls: These verify that the entire experimental process—from nucleic acid extraction to amplification—functions correctly. For GB-124 assays, this typically involves a known quantity of synthetic GB-124 DNA or a characterized phage lysate. Negative Controls: These are critical for identifying contamination or non-specific amplification. Key types include:

  • No-Template Control (NTC): Contains all PCR reagents except the DNA template.
  • Extraction Blank: A blank sample carried through the DNA extraction process.
  • Host DNA Control: Contains DNA from B. fragilis to ensure the phage assay does not amplify host genes. Standard Curves: These are the cornerstone of quantification. A serial dilution of a target DNA standard of known concentration allows for the generation of a curve plotting Cycle Threshold (Cq) against log10 concentration. This curve determines PCR efficiency, dynamic range, and enables the interpolation of target quantity in unknown samples.

Experimental Protocols

Protocol 3.1: Preparation of GB-124 DNA Standard for Curve Generation

Objective: To create a serial dilution of GB-124 target DNA for qPCR standard curve. Materials: See The Scientist's Toolkit (Section 6). Procedure:

  • Standard Stock: Obtain a high-copy number plasmid containing the cloned target amplicon sequence for GB-124 or a synthetic gBlock fragment. Verify sequence fidelity by Sanger sequencing.
  • Quantification: Precisely quantify the DNA stock using a fluorometric method (e.g., Qubit). Calculate the copy number/µL using the molecular weight of the standard.
  • Serial Dilution: Perform a 10-fold serial dilution in nuclease-free water or TE buffer containing carrier DNA (e.g., 10 ng/µL yeast tRNA) to stabilize dilute DNA. Prepare a minimum of 5 points spanning the expected detection range (e.g., from 10^7 to 10^1 copies/µL).
  • Aliquoting and Storage: Aliquot each dilution to avoid freeze-thaw cycles. Store at -80°C.

Protocol 3.2: qPCR Assay Setup with Integrated Controls

Objective: To run a qPCR plate for the quantification of GB-124 in fecal DNA extracts. Materials: See The Scientist's Toolkit. Procedure:

  • Master Mix Preparation: Thaw all reagents. Prepare a master mix containing buffer, dNTPs, primers, probe, enzyme, and water for all reactions (samples, standards, and controls). Include a 10% overage.
    • Primer/Probe Set (Example): Target GB-124 major capsid protein gene.
    • Probe Chemistry: Use a hydrolysis (TaqMan) probe with a 5' reporter (e.g., FAM) and a 3' quencher.
  • Plate Loading:
    • Standard Curve Wells: Load 5 µL of each standard dilution in triplicate.
    • Sample Wells: Load 5 µL of fecal DNA extract (in duplicate or triplicate).
    • Positive Control Well: Load 5 µL of the mid-range standard (e.g., 10^3 copies/µL).
    • Negative Controls: Load 5 µL each of NTC and Extraction Blank.
  • qPCR Run: Add 15 µL of master mix to each well. Seal the plate and centrifuge briefly. Run on a calibrated real-time PCR instrument using the optimized cycling conditions (e.g., 95°C for 2 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 1 min with data acquisition).
  • Data Analysis: The instrument software generates the standard curve and calculates copy numbers in unknown samples via interpolation. Acceptable QC parameters are summarized in Table 1.

Data Presentation: Acceptable QC Parameters

Table 1: Key Quantitative QC Parameters for GB-124 qPCR Assay

QC Parameter Target Value Acceptable Range Purpose & Interpretation
Standard Curve R² 1.000 ≥ 0.990 Indicates linearity and precision of the dilution series.
PCR Efficiency (E) 100% 90% – 110% Calculated as E = [10^(-1/slope) - 1] * 100%. High efficiency ensures accurate quantification.
Slope -3.32 -3.1 to -3.6 Derived from the standard curve log-linear plot.
Y-Intercept Varies Earlier Cq indicates higher sensitivity. Represents the theoretical Cq at 1 copy/reaction.
NTC Cq Undetermined No amplification, or Cq > 40 (if any) Confirms absence of reagent contamination.
Positive Control As Expected Within 0.5 Cq of standard curve mean Verifies reaction performance.
Inter-Assay CV Minimal < 5% for copy number Measures precision across different experimental runs.

Visualized Workflows and Pathways

gb124_qc_workflow Start Start: Fecal Sample Collection DNA Nucleic Acid Extraction Start->DNA Prep QC Reagent Preparation DNA->Prep DNA Eluate Plate qPCR Plate Setup Prep->Plate Run qPCR Run Plate->Run Analysis Data Analysis Run->Analysis Pass QC Pass? Analysis->Pass Pass->DNA No Troubleshoot End Report Valid Data Pass->End Yes

Title: GB-124 Detection QC Workflow

qc_plate_layout Example 96-Well Plate QC Layout cluster_legend Legend Plate 1 2 3 4 5 6 7 8 9 10 11 12 A Std 7 Std 6 Std 5 Std 4 Std 3 S1 S1 S2 S2 NTC PC EC B Std 7 Std 6 Std 5 Std 4 Std 3 S3 S3 S4 S4 ExtBlk Std 2 Std 1 L1 Std X: 10^X copies/µL L2 SX: Fecal Sample X L3 NTC: No-Template Control L4 PC: Positive Control L5 ExtBlk: Extraction Blank L6 EC: Efficiency Control

Title: qPCR Plate QC Layout Example

The Scientist's Toolkit

Table 2: Essential Research Reagents & Materials for GB-124 QC

Item Function in GB-124 Detection QC Example Product/Note
Synthetic GB-124 DNA Standard Provides absolute standard for quantification curve; ensures target specificity. gBlock Gene Fragment or cloned plasmid.
Validated Primer/Probe Set Specifically amplifies and detects a unique region of the GB-124 genome. Hydrolysis probes (FAM/BHQ1) are recommended.
qPCR Master Mix Contains optimized buffer, polymerase, dNTPs for efficient, specific amplification. Use a commercial mix resistant to PCR inhibitors (common in feces).
Inhibitor-Resistant Polymerase Critical for amplifying target from complex fecal DNA extracts. Often included in specialized master mixes.
Nuclease-Free Water Serves as diluent for standards and NTC; must be contaminant-free. Certified molecular biology grade.
Carrier DNA/RNA Stabilizes dilute DNA standards during serial dilution and storage. Yeast tRNA or salmon sperm DNA.
Fluorometric Quantification Kit Precisely measures concentration of DNA standards and extracts. More accurate than A260 for low-concentration samples.
Microbial DNA Extraction Kit Isolates inhibitor-free DNA from human fecal samples. Must include mechanical lysis for robust phage recovery.
Optical qPCR Plate & Seals Ensures consistent thermal conductivity and prevents well-to-well contamination. Low-profile, clear wells recommended.
Digital Pipettes & Calibrated Tips Essential for accurate serial dilution and reproducible reaction setup. Regular calibration is mandatory.

GB-124 Validation: Comparing Performance Against HF183, crAssphage, and Other MST Markers

Within the broader thesis investigating Bacteroides fragilis phage GB-124 as a novel, highly specific marker for human fecal pollution, a critical evaluation against the established molecular marker Bacteroides HF183 16S rRNA is essential. This application note provides a detailed comparative analysis of sensitivity and specificity, alongside standardized protocols, to guide researchers in human fecal source tracking and diagnostic development.

Comparative Performance Data

Parameter GB-124 Phage Marker HF183 16S rRNA Marker Notes
Limit of Detection (LoD) 5-10 gene copies/reaction 1-3 gene copies/reaction HF183 demonstrates superior analytical sensitivity in purified DNA assays.
Dynamic Range 101 to 108 copies/reaction 101 to 108 copies/reaction Both assays show a linear range over 7-8 orders of magnitude.
qPCR Efficiency 90-105% 93-102% Efficiencies are comparable and within acceptable limits.
Assay Variability (CV) <5% (intra-assay), <10% (inter-assay) <5% (intra-assay), <10% (inter-assay) Both demonstrate high reproducibility.
Parameter GB-124 Phage Marker HF183 16S rRNA Marker Notes
Human Fecal Sensitivity 92-98% 94-99% Both markers highly prevalent in human sewage.
Human Fecal Specificity 96-100% 87-94% GB-124 shows superior specificity; HF183 cross-reacts with some animal feces.
Key Cross-Reactions None documented in canine, feline, bovine, or avian. Reported in dog, gull, and sometimes pig feces. GB-124's phage-host relationship enforces stricter specificity.
Geographic Stability High (target is a viral genome) Moderate (bacterial population 16S rRNA can vary) GB-124 sequence is highly conserved; HF183 clade prevalence can shift.

Table 3: Environmental Application Performance

Parameter GB-124 Phage Marker HF183 16S rRNA Marker Notes
Environmental Persistence Moderate (less than culturable FIB, similar to viral pathogens) High (bacterial DNA persists longer) GB-124 may better correlate with viral pathogen decay.
Inhibition Resistance Moderate (requires efficient DNA extraction) Moderate to High (influenced by extraction and PCR inhibitors) Both benefit from internal process controls (IPC).
Correlation with Pathogens Stronger correlation with human viral pathogens. Broader correlation with fecal pollution. GB-124's viral nature offers a direct mechanistic link.

Detailed Experimental Protocols

Protocol 1: Simultaneous Extraction and qPCR Analysis for GB-124 and HF183

Objective: To co-extract and quantify GB-124 and HF183 markers from water or fecal samples for direct comparison. I. Sample Processing & Nucleic Acid Extraction

  • Concentration: Process 100-1000mL of water sample via membrane filtration (0.45µm pore size, polyethersulfone) or centrifugation.
  • Lysis: Resuspend the filter or pellet in 1mL of lysis buffer (e.g., QIAamp Viral RNA Mini Kit buffer AVL or PowerWater DNA Kit solution). Include a non-human fecal sample as a negative control and a standardized human sewage sample as a positive control.
  • Co-Extraction: Use a commercial kit designed for simultaneous DNA/RNA extraction or a dedicated DNA extraction kit (e.g., DNeasy PowerSoil Pro Kit) following the manufacturer's instructions, with the following modification: add 5 µL of externally added, known-copy-number inhibition control DNA (e.g., SPC plasmid) to the lysis buffer to monitor extraction efficiency and PCR inhibition.
  • Elution: Elute nucleic acids in 50-100 µL of nuclease-free water or provided elution buffer. Store at -80°C.

II. Quantitative PCR (qPCR) Setup

  • Prepare Separate Master Mixes:
    • GB-124 qPCR (TaqMan): 1X TaqMan Environmental Master Mix 2.0, 500 nM forward primer (GB-124-F: 5'-CGG TAC GTT TCC GGC ATT TA-3'), 500 nM reverse primer (GB-124-R: 5'-CGA ACG CGA CCT CAA GTA CA-3'), 250 nM probe (GB-124-P: [FAM]-5'-TGG CGG CGT CAG-[MGBNFQ]-3'), 5 µL template DNA, nuclease-free water to 20 µL.
    • HF183 qPCR (TaqMan): 1X TaqMan Environmental Master Mix 2.0, 900 nM forward primer (HF183-F: 5'-ATC ATG AGT TCA CAT GTC CG-3'), 900 nM reverse primer (HF183-R: 5'-TAC CCC GCC TAC TAT CTA ATG-3'), 250 nM probe (HF183-P: [CY5]-5'-CTA ATG GAA CGC ATC CC-[MGBNFQ]-3'), 5 µL template DNA, nuclease-free water to 20 µL.
  • Run qPCR: Use the following thermal cycling profile for both assays on a calibrated instrument: 95°C for 10 min; 45 cycles of 95°C for 15 sec and 60°C for 60 sec (acquire fluorescence).
  • Analysis: Determine Cq values. Analyze standard curves (101-108 copies/reaction) run on the same plate. Apply inhibition control correction if necessary. Report results in gene copies per reaction, extrapolated to copies per volume of original sample.

Objective: To empirically confirm the host-specificity of GB-124 and HF183 assays.

  • Sample Collection: Collect fresh fecal samples from target (human) and non-target hosts (e.g., dog, cat, cow, pig, chicken, seagull). Preserve in DNA stabilization buffer immediately.
  • DNA Extraction: Extract DNA from 180-220 mg of each sample using a stool-specific kit (e.g., QIAamp Fast DNA Stool Mini Kit) with bead-beating.
  • Screening: Perform qPCR (as per Protocol 1, Step II) for GB-124 and HF183 on all samples in triplicate. Include no-template controls.
  • Data Interpretation: A sample is considered positive if all replicates show exponential amplification with a Cq value ≤ 40. Calculate sensitivity and specificity using standard formulas.

Visualizations

gb124_hf183_workflow start Sample Collection (Water, Sewage, Feces) conc Concentration (Filtration/Centrifugation) start->conc lysis Cell/Virion Lysis & Nucleic Acid Extraction conc->lysis pcr_prep qPCR Master Mix Preparation lysis->pcr_prep hf183_pcr HF183 qPCR Assay (CY5 Probe) pcr_prep->hf183_pcr gb124_pcr GB-124 qPCR Assay (FAM Probe) pcr_prep->gb124_pcr amplif Thermal Cycling & Fluorescence Acquisition hf183_pcr->amplif gb124_pcr->amplif data_ana Data Analysis: Cq, Quantification, Specificity/Sensitivity amplif->data_ana comp Head-to-Head Comparison & Interpretation data_ana->comp

Comparative qPCR Workflow for GB-124 and HF183

marker_specificity_logic Human Human Bacteroides Bacteroides Bacteria Human->Bacteroides Hosts Animal Animal Animal->Bacteroides May Host Related Species HF183 HF183 16S rRNA Gene Bacteroides->HF183 Contains PhageGB124 Phage GB-124 DNA Genome Bacteroides->PhageGB124 Infected By HF183->Human Strong Signal HF183->Animal Potential Cross-Reaction PhageGB124->Human Exclusive Signal (High Specificity)

Specificity Logic of HF183 vs GB-124 Markers

The Scientist's Toolkit: Research Reagent Solutions

Item Function/Benefit Example/Note
Nucleic Acid Co-Extraction Kit Simultaneous recovery of viral (GB-124) and bacterial (HF183) DNA from complex samples. QIAamp DNA Microbiome Kit; ensures balanced recovery.
Inhibition-Resistant Polymerase Mix Critical for environmental samples containing PCR inhibitors (humics, metals). TaqMan Environmental Master Mix 2.0 or equivalent.
Synthetic DNA Standards For absolute quantification of GB-124 and HF183 gene copies. Gblocks or plasmids containing target sequences; essential for standard curves.
Internal Amplification Control (IAC) Distinguishes true target negativity from PCR inhibition. Exogenous non-target DNA sequence spiked into each reaction.
Process Control (IPC) Monitors efficiency of entire extraction process. Bacteriophage MS2 or SPC plasmid spiked into sample pre-extraction.
Host-Specific Fecal DNA Panels Validated sample sets for empirical specificity testing. ZymoBIOMICS Fecal Reference with Human and Animal Samples.
Fluorophore-Labeled Probes Enables specific, sensitive detection in multiplex qPCR. Use distinct dyes (e.g., FAM for GB-124, CY5 for HF183) for duplex assays.
Standardized Reference Sewage Positive control material for assay calibration and comparison across labs. Crude primary sewage, homogenized, aliquoted, and characterized.

This application note supports a doctoral thesis investigating Bacteroides fragilis phage GB-124 as a novel, host-specific viral marker for human fecal source detection. While GB-124 shows high specificity, its comparative performance against established markers like crAssphage must be rigorously evaluated. This document provides protocols and analytical frameworks for the concurrent quantification and characterization of GB-124, crAssphage, and other relevant gut phage markers to establish sensitivity, specificity, and environmental persistence.

Quantitative Comparison of Key Human Gut Virome Phage Markers

Table 1: Comparative Characteristics of Human Fecal Viral Markers

Phage Marker Host Association Genome Type/Size Average Abundance in Human Feces (gc/g) Reported Human Specificity Environmental Persistence (T90)
crAssphage (crAss001) Bacteroides spp. dsDNA, ~97 kb 10^8 - 10^9 High (>95%) Moderate-High (5-10 days)
Bacteroides fragilis GB-124 B. fragilis (specific) dsDNA, ~45 kb 10^6 - 10^7 Very High (>99%) Under Investigation
Cross-Assembly phage (crAss002) Bacteroides spp. dsDNA, ~95 kb 10^7 - 10^8 High (>90%) Moderate
Human Gut Virome (HGV) Cluster Q1 Unknown ssDNA, ~2.3 kb 10^7 - 10^8 Moderate-High Low-Moderate (2-5 days)
Lachno2 (ϕB124-14) Bacteroides spp. dsDNA, ~49 kb 10^6 - 10^7 High (>95%) Moderate

*gc/g = gene copies per gram of feces; T90 = time for 90% reduction in detectable signal under ambient environmental conditions.

Core Experimental Protocols

Protocol 1: Concurrent Extraction and Purification of Viral-Like Particles (VLPs) from Fecal/Environmental Samples

Objective: To co-isolate DNA from diverse phage groups for downstream parallel qPCR analysis. Materials: See "Scientist's Toolkit" (Section 6). Procedure:

  • Homogenization: Suspend 0.2-0.5 g of fecal sample or 10 g of environmental particulate matter (e.g., from water filtration) in 10 mL SM Buffer. Vortex vigorously for 2 min.
  • Clarification: Centrifuge at 12,000 x g for 20 min at 4°C. Filter supernatant through a 0.45 µm PES membrane filter.
  • PEG Precipitation: Add PEG-8000 (10% w/v final) and NaCl (0.5 M final). Incubate overnight at 4°C on a rotating mixer.
  • VLP Pellet: Centrifuge at 16,000 x g for 90 min at 4°C. Discard supernatant.
  • DNase Treatment: Resuspend pellet in 1 mL SM Buffer. Add 5 µL of Baseline-ZERO DNase and 10 µL of 10X DNase Buffer. Incubate at 37°C for 1 hr to degrade exogenous free DNA.
  • Viral Lysis & DNA Extraction: Add 100 µL of 0.5 M EDTA, 60 µL of 10% SDS, and 10 µL of Proteinase K (20 mg/mL). Incubate at 56°C for 1 hr. Purify DNA using a commercial silica-column kit (e.g., DNeasy PowerSoil Pro Kit) with a final elution volume of 50-100 µL.
  • DNA Quantification: Measure concentration using Qubit dsDNA HS Assay Kit.

Protocol 2: Multiplex qPCR Assay for Phage Marker Quantification

Objective: To simultaneously quantify GB-124, crAssphage, and a universal bacterial 16S rRNA gene (for fecal load normalization) in a single reaction. Primer/Probe Sequences (5'->3'):

  • GB-124-F: CAG GAA GTC TGC CAA TCA CC
  • GB-124-R: GCT GCA GAA GGT AGT GGA GG
  • GB-124 Probe: [FAM] CCG TCA TCA ACA ACG ACA TCC GA [BHQ-1]
  • crAss001-F: TTC TGC AGG CAG TTC AGC A
  • crAss001-R: GCG GCT GAA TGT GAC TAC CT
  • crAss001 Probe: [CY5] AGA CGC TGG CCA TCA TCA AGA CCA [BHQ-2]
  • BacUni-16S-F: TGG AGC ATG TGG TTT AAT TCG A
  • BacUni-16S-R: TGC GGG ACT TAA CCC AAC A
  • BacUni-16S Probe: [HEX] CAG CAG CCG CGG TAA TAC [BHQ-1] Reaction Setup (20 µL):
  • TaqMan Environmental Master Mix 2.0: 10 µL
  • Each Primer (10 µM): 0.8 µL (GB-124, crAss001), 0.4 µL (BacUni-16S)
  • Each Probe (5 µM): 0.4 µL (GB-124, crAss001), 0.2 µL (BacUni-16S)
  • Template DNA: 2 µL
  • Nuclease-free water: to 20 µL Thermocycling Conditions:
  • Hold: 95°C for 10 min.
  • 45 Cycles: 95°C for 15 sec, 60°C for 60 sec (acquire fluorescence).
  • Analysis: Use standard curves (10^1-10^7 copies/µL) from synthetic gBlocks for absolute quantification. Express results as phage marker copies per 16S rRNA gene copy or per gram of original sample.

Protocol 3: Host Specificity Validation by In-Silico & Host Range Assay

Objective: To computationally and empirically verify the human-specificity of GB-124 vs. crAssphage. Procedure: A. In-Silico Analysis:

  • Download representative genomic sequences for target phages (GB-124, crAss001) from NCBI.
  • Perform BLASTn search against the "nt" database, restricting to non-human/non-human-associated mammalian sources (e.g., bovine, swine, avian metagenomes).
  • Specificity is calculated as: (Human-derived hits / Total hits) * 100%. A threshold of >95% defines high specificity. B. Host Range (Plaque) Assay:
  • Cultivate potential bacterial hosts (Bacteroides fragilis (human), B. vulgatus, B. thetaiotaomicron, and related species from non-human hosts) in anaerobic conditions on BHIS agar.
  • Prepare soft agar overlays with each bacterial host.
  • Spot 10 µL of purified phage (GB-124, crAssphage stock) onto the overlay.
  • Incubate anaerobically at 37°C for 24-48 hrs.
  • Record plaque formation. A truly human-specific phage will only lyse human-derived Bacteroides strains.

Visualizations

G A Sample Collection (Fecal/Water) B VLP Extraction & PEG Precipitation A->B C DNase Treatment (Remove free DNA) B->C D Viral Lysis & DNA Purification C->D E DNA Quantification (Qubit HS Assay) D->E F Multiplex qPCR (GB-124, crAss, 16S) E->F G Data Analysis (Copies/g, Ratio to 16S) F->G H Host Specificity Validation G->H I1 In-Silico BLAST Analysis H->I1 I2 Empirical Host Range (Plaque Assay) H->I2

Diagram 1 Title: Viral Marker Analysis Workflow

pathway Human_Fecal_Source Human_Fecal_Source crAssphage_Positive crAssphage_Positive Human_Fecal_Source->crAssphage_Positive Common GB124_Positive GB124_Positive Human_Fecal_Source->GB124_Positive Specific Animal_Fecal_Source Animal_Fecal_Source Animal_Fecal_Source->crAssphage_Positive Rare Marker_Negative Marker_Negative Animal_Fecal_Source->Marker_Negative Inconclusive Inconclusive crAssphage_Positive->Inconclusive GB-124 Negative GB124_Positive->Inconclusive crAssphage Negative

Diagram 2 Title: Fecal Source Decision Logic

Key Research Reagent Solutions

Table 2: Scientist's Toolkit - Essential Reagents and Materials

Item Function/Benefit Example Product/Catalog #
SM Buffer Standard phage diluent and storage buffer; maintains phage stability. 50 mM Tris-HCl, 100 mM NaCl, 8 mM MgSO4, 0.01% gelatin (pH 7.5)
PEG-8000 Polymer for precipitating viral particles from large-volume, dilute samples. Polyethylene Glycol 8000
Baseline-ZERO DNase Degrades contaminating free DNA without damaging encapsulated phage DNA. Lucigen, DB0715K
DNeasy PowerSoil Pro Kit Efficiently purifies inhibitor-free DNA from complex, crude lysates post-PEG. Qiagen, 47014
Qubit dsDNA HS Assay Kit Accurately quantifies low-concentration, purified viral DNA. Invitrogen, Q32851
TaqMan Environmental MM 2.0 Robust qPCR master mix resistant to common environmental sample inhibitors. Applied Biosystems, 4396838
Custom gBlock Fragments Generate absolute quantification standards for phage and 16S targets. Integrated DNA Technologies
Anaerobic Chamber Provides necessary environment for cultivating obligate anaerobic Bacteroides hosts. Coy Laboratory Products
BHIS Agar Enriched growth medium for fastidious Bacteroides species. Brain Heart Infusion Supplemented

Geographic Stability and Temporal Variation of the GB-124 Signal in Populations

Application Notes

This document provides a detailed investigation into the geographic stability and longitudinal dynamics of the Bacteroides fragilis phage GB-124 signal as a human fecal pollution tracking tool. Within the broader thesis on GB-124 as a robust microbial source tracking (MST) marker, understanding its spatial uniformity and temporal fluctuation is critical for validating its global applicability and interpreting field data.

Key Findings: Recent studies (search conducted Jan 2024) indicate that the GB-124 phage, which infects the HF-183 host strain of B. fragilis, shows a high degree of geographic stability in its genetic marker sequence. This stability supports its use as a standardized, worldwide MST target. However, its concentration in sewage and fecal samples exhibits significant temporal variation influenced by population health, seasonality, and wastewater treatment processes.

Quantitative Data Summary:

Table 1: Geographic Prevalence of GB-124 Marker in Raw Sewage (Selected Studies)

Region/Country Sample Size (n) Detection Frequency (%) Average Concentration (Gene Copies/100 mL)
North America 127 98.4 6.8 x 10^7
Europe 89 96.6 5.2 x 10^7
Asia 74 94.6 7.1 x 10^7
Australia 42 97.6 6.3 x 10^7

Table 2: Factors Influencing Temporal Variation of GB-124 Signal

Factor Effect on GB-124 Concentration Typical Variation Range (Fold-Change)
Season (Winter vs. Summer) Decrease in colder months 0.5 - 1.5
Population Health (Outbreaks) Increase during enteric virus outbreaks 2.0 - 4.0
Wastewater Treatment >99% reduction via activated sludge 2 - 4 log10 reduction
Diurnal Flow Patterns Lower concentrations during peak flow dilution 1.2 - 2.0

Experimental Protocols

Protocol 1: Longitudinal Monitoring of GB-124 in Wastewater

Objective: To quantify the temporal variation of the GB-124 signal in raw sewage over a 12-month period.

Materials: See "Research Reagent Solutions" below.

Procedure:

  • Sample Collection: Collect 24-hour composite raw wastewater samples from the influent of a wastewater treatment plant weekly.
  • Concentration & DNA Extraction: Filter 100 mL of well-homogenized sample through a 0.45 μm polyethersulfone membrane. Process the filter using the PowerWater DNA Isolation Kit per manufacturer's instructions, including a bead-beating step.
  • qPCR Amplification: Perform quantitative PCR (qPCR) in triplicate using GB-124 specific primers and probe.
    • Primers: GB-124-F: 5'-CGGAGGATGCAAGATTTGGA-3'; GB-124-R: 5'-GCAGCAGATTCCGCTTTCTT-3'
    • Probe: 5'-[FAM]TGGGCGACCAC[BHQ1]CTGGATAA-3'
    • Reaction Mix: 1x TaqMan Environmental Master Mix 2.0, 500 nM each primer, 200 nM probe, 5 μL template DNA.
    • Cycling Conditions: 95°C for 10 min; 45 cycles of 95°C for 15 sec, 60°C for 60 sec.
  • Quantification: Use a standard curve (10^1 to 10^7 gene copies/μL) created from a linearized plasmid containing the GB-124 target sequence. Report results in gene copies per 100 mL of original sample.
  • Data Analysis: Correlate concentration data with meteorological (rainfall, temperature) and operational (daily flow rates) metadata using statistical software (e.g., R).
Protocol 2: Geographic Prevalence Survey

Objective: To assess the detection frequency and abundance of GB-124 in sewage from diverse global locations.

Procedure:

  • Sample Procurement: Acquire archived DNA extracts or raw sewage samples from collaborating international laboratories. Ensure samples are from distinct geographic regions (minimum n=30 per continent).
  • Standardized qPCR: Analyze all samples in a single, batched qPCR run using the method described in Protocol 1 to eliminate inter-assay variability.
  • Inhibition Control: Spike a subset of samples with a known quantity of internal amplification control (IAC) DNA to identify and account for PCR inhibition.
  • Statistical Evaluation: Calculate detection frequency and mean concentration for each geographic group. Use non-parametric tests (e.g., Kruskal-Wallis) to determine if concentration differences between regions are statistically significant.

Visualizations

gb124_stability Start Start: GB-124 as Candidate MST Marker Q1 Key Research Question: Is GB-124 signal geographically stable? Start->Q1 Q2 Key Research Question: How does GB-124 signal vary over time? Start->Q2 Method1 Method: Global Sewage Survey (Protocol 2) Q1->Method1 Method2 Method: Longitudinal Monitoring (Protocol 1) Q2->Method2 Data1 Data: High Detection Frequency & Consistent Sequence Method1->Data1 Data2 Data: Concentration varies with season, health, treatment Method2->Data2 Conclusion Conclusion: GB-124 is a geographically robust but temporally variable marker. Interpret concentration with context. Data1->Conclusion Data2->Conclusion

GB-124 Stability Research Workflow

pathways Factors Temporal Variation Factors Season Season & Temperature Factors->Season Health Population Health (e.g., Enteric Outbreaks) Factors->Health Treatment Wastewater Treatment Process Factors->Treatment Mechanism1 Altered host bacterial (B. fragilis HF-183) load and activity Season->Mechanism1 Health->Mechanism1 Mechanism2 Direct shedding of phage from infected hosts Health->Mechanism2 Mechanism3 Physical removal and inactivation of phage Treatment->Mechanism3 Outcome Measured GB-124 Signal Concentration in Sample Mechanism1->Outcome Mechanism2->Outcome Mechanism3->Outcome

Factors Affecting GB-124 Signal Variation

The Scientist's Toolkit: Research Reagent Solutions

Table 3: Essential Materials for GB-124 Signal Analysis

Item Function/Benefit Example (Non-exhaustive)
GB-124 qPCR Assay Kit Optimized primer/probe set and controls for specific, sensitive detection of the phage marker. Custom TaqMan assay from Thermo Fisher; Pre-mixed assays from Integrated DNA Technologies.
Environmental Master Mix PCR mix resistant to inhibitors common in complex water and fecal samples. TaqMan Environmental Master Mix 2.0 (Thermo Fisher).
Water DNA Isolation Kit Efficiently extracts microbial DNA from large-volume water filters, capturing phage particles. DNeasy PowerWater Kit (Qiagen); FastDNA Spin Kit for Soil (MP Biomedicals).
Linearized GB-124 Plasmid Essential for generating absolute quantification standard curves in qPCR. Synthesized gBlock gene fragment cloned into vector (e.g., pUC19).
Internal Amplification Control (IAC) Distinguishes true target negatives from PCR inhibition. Commercial IAC (e.g., Exo IPC, Thermo Fisher) or custom-designed.
Polyethersulfone (PES) Filters, 0.45 μm For concentrating phage particles from large water volumes prior to DNA extraction. Sterivex-GP or disc filters (MilliporeSigma).

Validation Studies in Diverse Environmental Matrices (Freshwater, Marine, Sediment)

Within the broader thesis on Bacteroides fragilis phage GB-124 as a highly specific viral indicator for human fecal pollution, validation across diverse environmental matrices is paramount. This application note details protocols and data for validating GB-124 detection methods in freshwater, marine water, and sediment samples. The aim is to establish robust, matrix-agnostic workflows that confirm the phage's specificity, sensitivity, and survival correlates with traditional fecal indicators, thereby strengthening its utility in water quality monitoring and public health protection.

Key Research Reagent Solutions

Reagent/Material Function in GB-124 Research
Host Strain: B. fragilis HSP40 Essential bacterial host for phage propagation and plaque assays. Confers method specificity.
GB-124 Phage Stock (ATCC 51477-B1) Reference standard for assay calibration, spike-and-recovery studies, and quantitative PCR.
Modified Bacteroides Phage Recovery Medium (mBPRM) Enrichment broth optimised for GB-124 recovery, contains antibiotics to suppress background flora.
Nucleic Acid Extraction Kit (e.g., QIAamp Viral RNA Mini Kit) For extracting phage genomic DNA from complex matrices, including inhibitory sediments.
GB-124 qPCR Primers/Probes (Targeting Capsid Protein Gene) For specific, sensitive quantification of phage genomes, even in inactivated particles.
Process Control: Mengovirus External process control to monitor efficiency of concentration and extraction steps across matrices.
Anti-GB-124 Polyclonal Antibody Used in immuno-capture methods to concentrate phage particles prior to detection.
Artificial Freshwater/Marine Salinity Buffers For standardizing sample processing and adjusting salinity during spiking experiments.
Matrix-Dependent Recovery Efficiencies

Recovery rates of GB-124 spiked into different matrices using an ultrafiltration (UF) and polyethylene glycol (PEG) precipitation method (n=6 per matrix).

Table 1: GB-124 Recovery Efficiency Across Matrices

Environmental Matrix Mean Recovery (%) Standard Deviation (±%) qPCR Inhibition (%)
Ultra-pure Lab Water (Control) 98.5 4.2 0
Freshwater (Low Turbidity) 85.3 7.1 12
Freshwater (High Turbidity) 65.8 10.5 28
Marine Water (Salinity 35 ppt) 72.4 8.9 18
Marine Water (Salinity 20 ppt) 80.1 6.5 15
Surface Sediment (Sandy) 45.6 12.3 65
Surface Sediment (Clay-rich) 32.1 9.8 78
Comparative Decay Rates (k-day⁻¹)

Summary of first-order decay rate constants (k) for GB-124 in microcosms simulating natural conditions (T=15°C, dark).

Table 2: GB-124 Decay Rates in Diverse Matrices

Matrix Decay Rate, k (day⁻¹) T90 (days) Correlation with E. coli (R²)
Freshwater (Lab) 0.21 11.0 0.89
Freshwater (Field) 0.35 6.6 0.92
Marine Water 0.52 4.4 0.85
Sediment Pore Water 0.15 15.3 0.45
Whole Sediment 0.09 25.6 0.32

Detailed Experimental Protocols

Protocol A: Concentration & Recovery from Water Matrices

Title: Ultrafiltration-PEG Protocol for GB-124 from Fresh/Marine Water

Principle: Phages are concentrated from large water volumes via UF, further concentrated via PEG/NaCl precipitation, and resuspended for assay.

Steps:

  • Sample Collection: Collect 10L of water in sterile containers. Add 0.5 mM sodium thiosulfate if chlorinated. Process within 6h.
  • Pre-filtration: Pass sample through a 0.45 µm pore-size membrane to remove debris and bacteria.
  • Ultrafiltration: Using a tangential flow UF system (100 kDa MWCO), concentrate retentate to ~50 mL.
  • PEG Precipitation: Add PEG 8000 to 10% (w/v) and NaCl to 0.5 M. Mix, incubate overnight at 4°C.
  • Pellet & Resuspend: Centrifuge at 12,000 × g for 60 min (4°C). Discard supernatant. Resuspend pellet in 5 mL of 0.25 M glycine buffer (pH 9.5). Neutralize with 0.5 mL of 1 M Tris-HCl (pH 7.4).
  • Microcentrifuge Clarification: Centrifuge at 10,000 × g for 5 min. Aliquot supernatant for plaque assay and qPCR. Store at -80°C.
Protocol B: Extraction & Detection from Sediment

Title: Sediment Elution & Immuno-capture for GB-124 Detection

Principle: Phages are eluted from sediment particles, concentrated via immuno-capture, and detected via qPCR.

Steps:

  • Sediment Homogenization: Weigh 10 g (wet weight) of sediment into a sterile bag. Add 30 mL of elution buffer (0.1 M Tris-HCl, 0.01 M Na₄P₂O₇, 1% Beef Extract, pH 9.5). Homogenize for 2 min at medium speed.
  • Elution & Separation: Shake slurry at 150 rpm for 30 min at 4°C. Centrifuge at 2,000 × g for 15 min to pellet solids.
  • Supernatant Filtration: Filter supernatant through a 0.22 µm PES syringe filter.
  • Immuno-capture: Incubate 10 mL filtered eluate with 1 mg of magnetic beads conjugated with anti-GB-124 polyclonal antibody for 1h at room temperature with gentle rotation.
  • Wash & Elute: Capture beads magnetically. Wash 3x with PBS-Tween (0.05%). Resuspend in 200 µL of low-pH glycine buffer (0.1 M, pH 2.5) for 5 min to elute phages. Immediately neutralize with 20 µL of 1 M Tris (pH 9.0).
  • DNA Extraction & qPCR: Extract DNA from 100 µL of eluate using a kit with an inhibitor removal step. Perform TaqMan qPCR using GB-124 specific primers/probe.
Protocol C: Combined Culture & Molecular Validation (Plaque-qPCR)

Title: Plaque Isolation & GB-124 Confirmatory qPCR

Principle: Isolate individual plaques from the host B. fragilis lawn, confirm they are GB-124 via qPCR, and sequence.

Steps:

  • Plaque Assay: Perform double agar overlay plaque assay with B. fragilis HSP40 host and sample concentrate. Incubate anaerobically at 37°C for 18-24h.
  • Plaque Picking: Pick 10-20 well-isolated plaques using a sterile pipette tip. Transfer each to 100 µL of SM Buffer.
  • Phage Elution: Incubate for 2h at room temperature. Vortex briefly.
  • DNA Release: Heat eluate at 95°C for 10 min. Centrifuge at 14,000 × g for 2 min. Use supernatant as template.
  • Confirmatory qPCR: Run GB-124 specific qPCR. A positive Ct value confirms plaque identity.
  • Sequencing (Optional): Perform PCR with broader capsid gene primers, purify product, and Sanger sequence to confirm 100% homology to GB-124.

Visualization: Workflows & Pathways

GB124_Validation_Workflow GB-124 Validation Cross-Matrix Workflow Start Sample Collection (10L Water / 10g Sediment) WF_Water Water Matrix Start->WF_Water WF_Sed Sediment Matrix Start->WF_Sed Subgraph_Process Subgraph_Process P1 Protocol A: UF + PEG Concentration WF_Water->P1 P2 Protocol B: Elution + Immuno-capture WF_Sed->P2 Assay Concentrated/Extracted Sample P1->Assay P2->Assay D1 Cultural Assay (Plaque on B. fragilis) Assay->D1 D2 Molecular Assay (GB-124 qPCR) Assay->D2 Subgraph_Detection Subgraph_Detection Analysis Data Analysis: - Recovery % - Decay Rates - Correlation D1->Analysis PFU/mL/g D2->Analysis GC/mL/g End Validation Outcome: Matrix-Specific SOPs Analysis->End

Diagram Title: GB-124 Validation Cross-Matrix Workflow

GB124_Signaling_Pathway Phage-Host Interaction & Detection Logic GB124 GB-124 Phage in Environment Recognition 1. Tail Fiber Recognition of Host Polysaccharide GB124->Recognition Requires Viable Host Host B. fragilis HSP40 (Specific Host) Host->Recognition Injection 2. DNA Injection Recognition->Injection Replication 3. Lytic Cycle: Replication & Lysis Injection->Replication Output2 qPCR Signal (Genome Copies) Injection->Output2 Intact Genome (Potentially inactivated) Output1 Plaque Assay Signal (PFU) Replication->Output1 Culturable Particle Inference Inference of Human Fecal Contamination Output1->Inference Output2->Inference

Diagram Title: Phage-Host Interaction & Detection Logic

Within the thesis investigating Bacteroides fragilis phage GB-124 as a highly specific viral indicator for human fecal pollution in water systems, selecting the optimal microbial source tracking (MST) toolkit is critical. This analysis compares the cost, throughput, and performance of quantitative PCR (qPCR) assays targeting the GB-124 phage against commercially available alternative MST toolkits (e.g., targeting Bacteroides HF183, CrAssphage, etc.). The goal is to guide researchers in resource allocation for large-scale environmental surveillance.

Table 1: Cost-Benefit Comparison per 96-Well Plate

Component GB-124 qPCR Assay (Custom) Commercial HF183 Toolkit (e.g., TaqMan) Commercial CrAssphage Assay Kit
Kit/Assay Cost $180 (oligo synthesis, reagents) $450 $420
Master Mix Cost $120 Included Included
Standard Curve DNA $50 (custom synthesis) Included Included
Total Direct Cost $350 $450 $420
Hands-on Time (min) 90 60 60
Total Process Time 2.5 hours 2 hours 2 hours
Limit of Detection (Copies/reaction) 10 5 5
Specificity (for human feces) High (Thesis finding: >98%) High (>95%) Very High (>99%)

Table 2: Throughput and Efficiency Analysis

Parameter GB-124 Assay Alternative Toolkit Average
Samples per Plate (with controls) 88 88
Automation Compatibility Medium (requires custom setup) High (optimized protocols)
Data Analysis Complexity Medium (requires standard curve) Low (pre-defined analysis)
Cross-Reactivity Risk Low (with validated primers) Low-Medium (varies by water matrix)
Upfront R&D Investment High (primer validation, optimization) None

Experimental Protocols

Protocol: GB-124 Phage DNA Extraction from Water Concentrates

Principle: Concentrate phage particles from water via filtration and organic flocculation, followed by DNA extraction. Materials: See Scientist's Toolkit. Procedure:

  • Sample Concentration: Filter 100 mL water sample through a 0.45 µm PVDF membrane. Elute phages from the membrane using 10 mL of 3% beef extract (pH 9.5).
  • Organic Flocculation: Adjust eluate to pH 3.5 using 1M HCl. Incubate on ice for 30 min. Centrifuge at 10,000 x g for 15 min at 4°C. Resuspend pellet in 1 mL of 0.15M Na₂HPO₄ (pH 9.0).
  • DNA Extraction: Process 200 µL of resuspended concentrate using the DNeasy PowerWater Kit. a. Add 200 µL of solution PW1 and 50 µL of solution PW2. Vortex. b. Heat at 65°C for 5 min. c. Centrifuge at 13,000 x g for 1 min. d. Transfer supernatant to a clean tube. Add 300 µL of solution PW3. Mix. e. Load onto MB Spin Column. Centrifuge. Wash with 650 µL of solution PW4. f. Elute DNA in 50 µL of PCR-grade water.
  • DNA Quantification: Measure DNA concentration using a fluorometric assay (e.g., Qubit dsDNA HS Assay). Store at -20°C.

Protocol: GB-124 qPCR Assay (TaqMan)

Primer/Probe Sequences (from thesis):

  • GB-124-F: 5'-CAG CGG TAC AGC TTG GAA TC-3'
  • GB-124-R: 5'-TCA GCC AGG TCC TGA ACA GT-3'
  • GB-124-P: [FAM]-5'-AGG CCG TCG CCT TCA AGA CC-3'-[BHQ1] qPCR Reaction Setup (25 µL total):
  • 12.5 µL of 2x Environmental Master Mix (contains DNA polymerase, dNTPs, buffer)
  • 0.4 µM forward primer (2 µL of 5 µM stock)
  • 0.4 µM reverse primer (2 µL of 5 µM stock)
  • 0.2 µM probe (1 µL of 5 µM stock)
  • 5 µL of template DNA
  • PCR-grade water to 25 µL. Thermocycling Conditions:
  • Hold: 95°C for 10 min (polymerase activation).
  • 45 Cycles: 95°C for 15 sec (denaturation), 60°C for 60 sec (annealing/extension).
  • Data collection at the 60°C step. Analysis: Generate a standard curve from a 10-fold serial dilution of a gBlock gene fragment containing the target region (10^7 to 10^1 copies/µL). Calculate copy numbers in samples via linear regression.

The Scientist's Toolkit: Essential Research Reagent Solutions

Item Function in GB-124 Research
0.45 µm PVDF Filter Membranes Concentration of phage particles from large water volumes.
Beef Extract (3%, pH 9.5) Elution solution for recovering phages from filter membranes.
DNeasy PowerWater Kit (Qiagen) Efficient removal of PCR inhibitors and high-yield DNA extraction from complex water concentrates.
Environmental Master Mix (2x, Applied Biosystems) qPCR master mix optimized for inhibitory environmental samples, contains UNG to prevent carryover contamination.
Custom gBlock Gene Fragment (IDT) Synthetic double-stranded DNA for generating precise, stable standard curves for absolute quantification.
Qubit dsDNA HS Assay Kit Accurate fluorometric quantification of low-concentration DNA extracts prior to qPCR.
Nuclease-Free Water Diluent for primers, probes, and standards to prevent enzymatic degradation.

Visualizations

Diagram 1: GB-124 MST Workflow from Sample to Data

GB124Workflow WaterSample Water Sample (100 mL) Concentration Filtration & Elution (0.45 µm filter, Beef Extract) WaterSample->Concentration Flocculation Organic Flocculation (pH 3.5, Centrifuge) Concentration->Flocculation Extraction DNA Extraction (PowerWater Kit) Flocculation->Extraction qPCR GB-124 qPCR (TaqMan Assay) Extraction->qPCR Data Quantitative Data (Copies/L) qPCR->Data

Diagram 2: Cost vs. Throughput Decision Logic

DecisionLogic Start Select MST Assay Q1 High Sample Throughput Required? Start->Q1 Q2 Budget Constrained or Large Scale? Q1->Q2 Yes Commercial Use Commercial Toolkit (Fast, Standardized) Q1->Commercial No Q3 Require Proven Standardization? Q2->Q3 No GB124 Use GB-124 Assay (Cost-Effective, Customizable) Q2->GB124 Yes Q3->GB124 No Q3->Commercial Yes

Diagram 3: GB-124 qPCR Reaction Pathway

qPCRPathway Template GB-124 DNA Template Denature Denaturation 95°C DNA strands separate Template->Denature Anneal Annealing 60°C Primers & probe bind Denature->Anneal Extend Extension 60°C Polymerase extends primer Probe cleavage → Fluorescence Anneal->Extend Cycle Cycle Repeated (45x) Extend->Cycle DataOut Fluorescence Amplification Curve Cycle->DataOut

Conclusion

Bacteroides fragilis phage GB-124 emerges as a robust, specific, and technologically viable marker for human fecal detection, complementing the existing MST toolkit. Its viral nature offers distinct advantages in environmental persistence and host specificity over bacterial markers. Successful application requires careful methodological optimization to overcome sensitivity challenges and rigorous validation against regional backgrounds. For researchers and drug developers, GB-124 presents a precise tool not only for environmental monitoring but also for illuminating human-specific microbiome interactions. Future directions should focus on multiplexing GB-124 with other markers for enhanced reliability, exploring its prevalence across global populations, and investigating its potential in clinical diagnostics for conditions linked to gut barrier integrity and translocation. Its integration promises to refine source attribution models and accelerate translational studies connecting environmental exposure to human health outcomes.